MED6 (NM_005466) Human Untagged Clone

CAT#: SC317351

MED6 (untagged)-Human mediator complex subunit 6 (MED6)



  "NM_005466" in other vectors (6)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
MED6 mouse monoclonal antibody, clone OTI3B9 (formerly 3B9)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ARC33; NY-REN-28
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC317351 representing NM_005466.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGGCGGTGGATATCCGAGACAATCTGCTGGGAATTTCTTGGGTTGACAGCTCTTGGATCCCTATT
TTGAACAGTGGTAGTGTCCTGGATTACTTTTCAGAAAGAAGTAATCCTTTTTATGACAGAACATGTAAT
AATGAAGTGGTCAAAATGCAGAGGCTAACATTAGAACACTTGAATCAGATGGTTGGAATCGAGTACATC
CTTTTGCATGCTCAAGAGCCCATTCTTTTCATCATTCGGAAGCAACAGCGGCAGTCCCCTGCCCAAGTT
ATCCCACTAGCTGATTACTATATCATTGCTGGAGTGATCTATCAGGCACCAGACTTGGGATCAGTTATA
AACTCTAGAGTGCTTACTGCAGTGCATGGTATTCAGTCAGCTTTTGATGAAGCTATGTCATACTGTCGA
TATCATCCTTCCAAAGGGTATTGGTGGCACTTCAAAGATCATGAAGAGCAAGATAAAGTCAGACCTAAA
GCCAAAAGGAAAGAAGAACCAAGCTCTATTTTTCAGAGACAACGTGTGGATGCTTTACTTTTAGACCTC
AGACAAAAATTTCCACCCAAATTTGTGCAGCTAAAGCCTGGAGAAAAGCCTGTTCCAGTGGATCAAACA
AAGAAAGAGGCAGAACCTATACCAGAAACTGTAAAACCTGAGGAGAAGGAGACCACAAAGAATGTACAA
CAGACAGTGAGTGCTAAAGGCCCCCCTGAAAAACGGATGAGACTTCAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_005466
Insert Size 741 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_005466.3
RefSeq Size 2386 bp
RefSeq ORF 741 bp
Locus ID 10001
UniProt ID O75586
Domains MED6
Protein Families Druggable Genome, Transcription Factors
MW 28.4 kDa
Gene Summary Component of the Mediator complex, a coactivator involved in the regulated transcription of nearly all RNA polymerase II-dependent genes. Mediator functions as a bridge to convey information from gene-specific regulatory proteins to the basal RNA polymerase II transcription machinery. Mediator is recruited to promoters by direct interactions with regulatory proteins and serves as a scaffold for the assembly of a functional preinitiation complex with RNA polymerase II and the general transcription factors.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) uses an alternate in-frame splice site, compared to variant 1. The encoded isoform (2) is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...