RSPO2 (NM_178565) Human Untagged Clone
CAT#: SC317347
RSPO2 (untagged)-Human R-spondin 2 homolog (Xenopus laevis) (RSPO2)
CNY 2,400.00
CNY 3,990.00
Cited in 1 publication. |
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CRISTIN2; HHRRD; TETAMS2 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_178565 edited
ATGCAGTTTCGCCTTTTCTCCTTTGCCCTCATCATTCTGAACTGCATGGATTACAGCCAC TGCCAAGGCAACCGATGGAGACGCAGTAAGCGAGCTAGTTATGTATCAAATCCCATTTGC AAGGGTTGTTTGTCTTGTTCAAAGGACAATGGGTGTAGCCGATGTCAACAGAAGTTGTTC TTCTTCCTTCGAAGAGAAGGGATGCGCCAGTATGGAGAGTGCCTGCATTCCTGCCCATCC GGGTACTATGGACACCGAGCCCCAGATATGAACAGATGTGCAAGATGCAGAATAGAAAAC TGTGATTCTTGCTTTAGCAAAGACTTTTGTACCAAGTGCAAAGTAGGCTTTTATTTGCAT AGAGGCCGTTGCTTTGATGAATGTCCAGATGGTTTTGCACCATTAGAAGAAACCATGGAA TGTGTGGAAGGATGTGAAGTTGGTCATTGGAGCGAATGGGGAACTTGTAGCAGAAATAAT CGCACATGTGGATTTAAATGGGGTCTGGAAACCAGAACACGGCAAATTGTTAAAAAGCCA GTGAAAGACACAATACCGTGTCCAACCATTGCTGAATCCAGGAGATGCAAGATGACAATG AGGCATTGTCCAGGAGGGAAGAGAACACCAAAGGCGAAGGAGAAGAGGAACAAGAAAAAG AAAAGGAAGCTGATAGAAAGGGCCCAGGAGCAACACAGCGTCTTCCTAGCTACAGACAGA GCTAACCAATAA |
Restriction Sites | Please inquire |
ACCN | NM_178565 |
Insert Size | 700 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to contain one SNP compared with NM_178565.3. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_178565.3, NP_848660.2 |
RefSeq Size | 2842 bp |
RefSeq ORF | 732 bp |
Locus ID | 340419 |
UniProt ID | Q6UXX9 |
Protein Families | Secreted Protein |
Gene Summary | This gene encodes a member of the R-spondin family of proteins. These proteins are secreted ligands of leucine-rich repeat containing G protein-coupled receptors that enhance Wnt signaling through the inhibition of ubiquitin E3 ligases. A chromosomal translocation including this locus that results in the formation of a gene fusion has been identified in multiple human cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Reconstitution of R-Spondin:LGR4:ZNRF3 Adult Stem Cell Growth Factor Signaling Complexes with Recombinant Proteins Produced in Escherichia coli
,Moad, HE;Pioszak, AA;,
Biochemistry. 2013 Oct 15;52(41):7295-304.
,PubMed ID 24050775
[RSPO2]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC224177 | RSPO2 (Myc-DDK-tagged)-Human R-spondin 2 homolog (Xenopus laevis) (RSPO2) |
CNY 2,400.00 |
|
RC224177L1 | Lenti ORF clone of Human R-spondin 2 homolog (Xenopus laevis) (RSPO2), Myc-DDK-tagged |
CNY 4,800.00 |
|
RC224177L2 | Lenti ORF clone of Human R-spondin 2 homolog (Xenopus laevis) (RSPO2), mGFP tagged |
CNY 5,890.00 |
|
RC224177L3 | Lenti ORF clone of Human R-spondin 2 homolog (Xenopus laevis) (RSPO2), Myc-DDK-tagged |
CNY 4,800.00 |
|
RC224177L4 | Lenti ORF clone of Human R-spondin 2 homolog (Xenopus laevis) (RSPO2), mGFP tagged |
CNY 4,800.00 |
|
RG224177 | RSPO2 (tGFP-tagged) - Human R-spondin 2 homolog (Xenopus laevis) (RSPO2) |
CNY 4,370.00 |
|
SC123361 | RSPO2 (untagged)-Human R-spondin 2 homolog (Xenopus laevis) (RSPO2) |
CNY 2,400.00 |