DHRS4L2 (NM_198083) Human Untagged Clone

CAT#: SC317337

DHRS4L2 (untagged)-Human dehydrogenase/reductase (SDR family) member 4 like 2 (DHRS4L2), transcript variant 1



  "NM_198083" in other vectors (7)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
DHRS4L2 mouse monoclonal antibody,clone OTI4A10
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms SDR25C3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC317337 representing NM_198083.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCAGATGGCCAGGCTGCTAGGCCTCTGTGCCTGGGCACGGAAGTCGGTGCGGATGGCCAGCTCCAGG
ATGACCCGCCGGGACCCGCTCACAAATAAGGTGGCCCTGGTAACGGCCTCCACCGACGGGATCGGCTTC
GCCATCGCCCGGCGTTTGGCCCAGGACAGGGCCCACGTGGTCGTCAGCAGCCGGAAGCAGCAGAATGTG
GACCAGGCGGTGGCCACGCTGCAGGGGGAGGGGCTGAGCGTGACGGGCACTGTGTGCCATGTGGGGAAG
GCGGAGGACCGGGAGCGGCTGGTGGCCATGGCTGTGAAGCTTCATGGAGGTATCGATATCCTAGTCTCC
AATGCTGCTGTCAACCCTTTCTTTGGAAGCCTAATGGATGTCACCGAGGAGGTGTGGGACAAGACTCTG
GACATTAATGTGAAGGCCCCAGCCCTGATGACAAAGGCAGTGGTGCCAGAAATGGAGAAACGAGGAGGC
GGCTCAGTGGTGATCGTGTCTTCCATAGCAGCCTTCAGTCCATCTCCTGGCTTCAGTCCTTACAATGTC
AGTAAAACAGCCTTGCTGGGCCTCAACAATACCCTGGCCATAGAGCTGGCCCCAAGGAACATTAGGGTG
AACTGCCTGCACCTGGACTTATCAAGACTAGCTTCAGCAGGATGCTCTGGATGGACAAGGAAAAAGAGG
AAAGCATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_198083
Insert Size 699 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_198083.3
RefSeq Size 1384 bp
RefSeq ORF 699 bp
Locus ID 317749
Protein Families Druggable Genome
Protein Pathways Metabolic pathways, Retinol metabolism
MW 24.9 kDa
Gene Summary This gene encodes a member of the short chain dehydrogenase reductase family. The encoded protein may be an NADPH dependent retinol oxidoreductase. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Aug 2010]
Transcript Variant: This variant (1) encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. CCDS Note: This CCDS representation uses the 5'-most in-frame start codon, which is conserved in other species. An alternative downstream start codon, which is specific to human and has a slightly stronger Kozak signal, also exists. It is possible that leaky scanning by ribosomes would allow the downstream start codon to be used, at least some of the time. The use of the downstream start codon would result in a protein that is 2 aa shorter at the N-terminus. There is no experimental evidence showing which start codon is preferentially used in vivo.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...