ILRUN (NM_022758) Human Untagged Clone

CAT#: SC317336

C6orf106 (untagged)-Human chromosome 6 open reading frame 106 (C6orf106), transcript variant 2



  "NM_022758" in other vectors (5)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-C6orf106 Antibody
    • 100 ul

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C6orf106; dJ391O22.4; FP852
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC317336 representing NM_022758.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGAGGGCATGGACGTAGACCTGGACCCGGAGCTGATGCAGAAGTTCAGCTGCCTGGGCACCACCGAC
AAGGACGTGCTCATCTCCGAGTTCCAGAGGCTGCTCGGCTTCCAGCTCAATCCTGCCGGTTGCGCCTTC
TTCCTGGACATGACCAACTGGAACCTACAAGCAGCAATTGGCGCCTATTATGACTTTGAGAGCCCAAAC
ATCAGTGTGCCCTCTATGTCCTTTGTTGAAGATGTCACCATAGGAGAAGGGGAGTCAATACCTCCGGAT
ACTCAGTTTGTAAAAACATGGCGGATCCAGAATTCTGATGTCATCTGGGTGATTCTCAGTGTGGAGGTG
GGTGGACTTTTAGGAGTAACGCAGCAGCTGTCATCTTTTGAAACGGAGTTCAACACACAGCCGCATCGT
AAGGTAGAAGGAAACTTCAACCCTTTTGCCTCTCCCCAAAAGAACCGACAATCAGATGAAAACAACTTA
AAAGACCCTGGGGGCTCCGAGTTCGACTCGATCAGCAAAAACACATGGGCTCCTGCTCCTGACACATGG
GCTCCTGCTCCTGACCAAACTGAGCAAGACCAGAATAGACTGTCACAGAACTCTGTAAATCTGTCTCCC
AGCAGTCACGCAAACAACTTATCAGTAGTGACTTACAGTAAGGGGCTCCATGGGCCTTACCCCTTCGGC
CAGTCTTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_022758
Insert Size 699 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_022758.5
RefSeq Size 4235 bp
RefSeq ORF 699 bp
Locus ID 64771
UniProt ID Q9H6K1
MW 25.7 kDa
Gene Summary Negative regulator of innate antiviral response. Blocks IRF3-dependent cytokine production such as IFNA, IFNB and TNF (PubMed:29802199). Interacts with IRF3 and inhibits IRF3 recruitment to type I IFN promoter sequences while also reducing nuclear levels of the coactivators EP300 and CREBBP (PubMed:29802199).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 5' coding region, compared to variant 1. It encodes isoform b, which is shorter than isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...