MPZL (MPZL1) (NM_024569) Human Untagged Clone

CAT#: SC317314

MPZL1 (untagged)-Human myelin protein zero-like 1 (MPZL1), transcript variant 2



  "NM_024569" in other vectors (5)

CNY 3,990.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


MPZL1 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms MPZL1b; PZR; PZR1b; PZRa; PZRb
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_024569, the custom clone sequence may differ by one or more nucleotides
ATGGCAGCGTCCGCCGGAGCCGGGGCGGTGATTGCAGCCCCAGACAGCCGGCGCTGGCTG
TGGTCGGTGCTGGCGGCGGCGCTTGGGCTCTTGACAGCTGGAGTATCAGCCTTGGAAGTA
TATACGCCAAAAGAAATCTTCGTGGCAAATGGTACACAAGGGAAGCTGACCTGCAAGTTC
AAGTCTACTAGTACGACTGGCGGGTTGACCTCAGTCTCCTGGAGCTTCCAGCCAGAGGGG
GCCGACACTACTGTGTCGTTTTTCCACTACTCCCAAGGGCAAGTGTACCTTGGGAATTAT
CCACCATTTAAAGACAGAATCAGCTGGGCTGGAGACCTTGACAAGAAAGATGCATCAATC
AACATAGAAAATATGCAGTTTATACACAATGGCACCTATATCTGTGATGTCAAAAACCCT
CCTGACATCGTTGTCCAGCCTGGACACATTAGGCTCTATGTCGTAGAAAAAGAGAATTTG
CCTGTGTTTCCAGTTTGGGTAGTGGTGGGCATAGTTACTGCTGTGGTCCTAGGTCTCACT
CTGCTCATCAGCATGATTCTGGCTGTCCTCTATAGAAGGAAAAACTCTAAACGGGATTAC
ACTGGGGCCCAGTCATATATGCACAGT
Restriction Sites Please inquire     
ACCN NM_024569
Insert Size 4923 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_024569.3, NP_078845.3
RefSeq Size 4923 bp
RefSeq ORF 4923 bp
Locus ID 9019
UniProt ID O95297
Protein Families Druggable Genome, Transmembrane
Protein Pathways Cell adhesion molecules (CAMs)
Gene Summary Cell surface receptor, which is involved in signal transduction processes. Recruits PTPN11/SHP-2 to the cell membrane and is a putative substrate of PTPN11/SHP-2. Is a major receptor for concanavalin-A (ConA) and is involved in cellular signaling induced by ConA, which probably includes Src family tyrosine-protein kinases. Isoform 3 seems to have a dominant negative role; it blocks tyrosine phosphorylation of MPZL1 induced by ConA. Isoform 1, but not isoform 2 and isoform 3, may be involved in regulation of integrin-mediated cell motility.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks an alternate coding exon compared to variant 1, that causes a frameshift. The resulting isoform (b) is shorter and has a distinct C-terminus compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...