United States
Germany
Japan
United Kingdom
China
TM2D2 (NM_031940) Human Untagged Clone
CAT＃: SC317267
TM2D2 (untagged)-Human TM2 domain containing 2 (TM2D2), transcript variant 2
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | BLP1 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC317267 representing NM_031940.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAAGAAATGTCTTTTGCCCGTTTTGATTACGTGCATGCAAACAGCGATTTGCAAAGACCGTATGATG ATGATCATGATCTTACTGGTGAATTACAGACCTGATGAATTTATAGAATGTGAAGACCCAGTGGATCAT GTTGGAAATGCAACTGCATCCCAGGAACTTGGTTATGGTTGTCTCAAGTTCGGCGGTCAGGCCTACAGC GACGTGGAACACACTTCAGTCCAGTGCCATGCCTTAGATGGAATTGAGTGTGCCAGTCCTAGGACCTTT CTACGAGAAAATAAACCTTGTATAAAGTATACCGGACACTACTTCATAACCACTTTACTCTACTCCTTC TTCCTGGGATGTTTTGGTGTGGATCGATTCTGTTTGGGACACACTGGCACTGCAGTAGGGAAGCTGTTG ACGCTTGGAGGACTTGGGATTTGGTGGTTTGTTGACCTTATTTTGCTAATTACTGGAGGGCTGATGCCA AGTGATGGCAGCAACTGGTGCACTGTTTACTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_031940 |
| Insert Size | 516 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_031940.3 |
| RefSeq Size | 3641 bp |
| RefSeq ORF | 516 bp |
| Locus ID | 83877 |
| UniProt ID | Q9BX73 |
| Domains | TM2 |
| Protein Families | Druggable Genome, Transmembrane |
| MW | 19 kDa |
| Gene Summary | The protein encoded by this gene contains a structural module related to that of the seven transmembrane domain G protein-coupled receptor superfamily. This protein has sequence and structural similarities to the beta-amyloid binding protein (BBP), but, unlike BBP, it does not regulate a response to beta-amyloid peptide. This protein may have regulatory roles in cell death or proliferation signal cascades. This gene has multiple alternatively spliced transcript variants which encode two different isoforms. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) differs in the 5' UTR and coding region compared to variant 1. The resulting isoform (b) is shorter and has a distinct N-terminus compared to isoform a. Variants 2, 3, and 4 all encode isoform b. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC202598 | TM2D2 (Myc-DDK-tagged)-Human TM2 domain containing 2 (TM2D2), transcript variant 2 |
CNY 2,400.00 |
|
| RC202598L3 | Lenti ORF clone of Human TM2 domain containing 2 (TM2D2), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC202598L4 | Lenti ORF clone of Human TM2 domain containing 2 (TM2D2), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG202598 | TM2D2 (tGFP-tagged) - Human TM2 domain containing 2 (TM2D2), transcript variant 2 |
CNY 4,000.00 |
|
| SC106725 | TM2D2 (untagged)-Human TM2 domain containing 2 (TM2D2), transcript variant 2 |
CNY 1,200.00 |
