United States
Germany
Japan
United Kingdom
China
Myosin (MYL6) (NM_079423) Human Untagged Clone
CAT＃: SC317249
MYL6 (untagged)-Human myosin, light chain 6, alkali, smooth muscle and non-muscle (MYL6), transcript variant 2
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | ESMLC; LC17; LC17-GI; LC17-NM; LC17A; LC17B; MLC-3; MLC1SM; MLC3NM; MLC3SM |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC317249 representing NM_079423.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTGTGACTTCACCGAAGACCAGACCGCAGAGTTCAAGGAGGCCTTCCAGCTGTTTGACCGAACAGGT GATGGCAAGATCCTGTACAGCCAGTGTGGGGATGTGATGAGGGCCCTGGGCCAGAACCCTACCAACGCC GAGGTGCTCAAGGTCCTGGGGAACCCCAAGAGTGATGAGATGAATGTGAAGGTGCTGGACTTTGAGCAC TTTCTGCCCATGCTGCAGACAGTGGCCAAGAACAAGGACCAGGGCACCTATGAGGATTATGTCGAAGGA CTTCGGGTGTTTGACAAGGAAGGAAATGGCACCGTCATGGGTGCTGAAATCCGGCATGTTCTTGTCACA CTGGGTGAGAAGATGACAGAGGAAGAAGTAGAGATGCTGGTGGCAGGGCATGAGGACAGCAATGGTTGT ATCAACTATGAAGAGCTCGTCCGCATGGTGCTGAATGGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_079423 |
| Insert Size | 456 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_079423.3 |
| RefSeq Size | 782 bp |
| RefSeq ORF | 456 bp |
| Locus ID | 4637 |
| UniProt ID | P60660 |
| Domains | EFh |
| Protein Families | Druggable Genome |
| Protein Pathways | Vascular smooth muscle contraction |
| MW | 17 kDa |
| Gene Summary | Myosin is a hexameric ATPase cellular motor protein. It is composed of two heavy chains, two nonphosphorylatable alkali light chains, and two phosphorylatable regulatory light chains. This gene encodes a myosin alkali light chain that is expressed in smooth muscle and non-muscle tissues. Genomic sequences representing several pseudogenes have been described and two transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) lacks an alternate coding exon compared to variant 1, that causes a frameshift. The resulting isoform (2) is the same length as isoform 1, but the proteins differ in their C-terminal sequences. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC224925 | MYL6 (Myc-DDK-tagged)-Human myosin, light chain 6, alkali, smooth muscle and non-muscle (MYL6), transcript variant 2 |
CNY 1,200.00 |
|
| RC224925L3 | Lenti ORF clone of Human myosin, light chain 6, alkali, smooth muscle and non-muscle (MYL6), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC224925L4 | Lenti ORF clone of Human myosin, light chain 6, alkali, smooth muscle and non-muscle (MYL6), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG224925 | MYL6 (tGFP-tagged) - Human myosin, light chain 6, alkali, smooth muscle and non-muscle (MYL6), transcript variant 2 |
CNY 2,800.00 |
|
| SC120266 | MYL6 (untagged)-Human myosin, light chain 6, alkali, smooth muscle and non-muscle (MYL6), transcript variant 2 |
CNY 1,200.00 |
