Cytochrome b5 Outer Mitochondrial Membrane (CYB5B) (NM_030579) Human Untagged Clone
CAT#: SC317248
CYB5B (untagged)-Human cytochrome b5 type B (outer mitochondrial membrane) (CYB5B), nuclear gene encoding mitochondrial protein
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CYB5-M; CYPB5M; OMB5 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC317248 representing NM_030579.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCCGGTTCAATGGCGACTGCGGAAGCTAGCGGCAGCGATGGGAAAGGGCAGGAAGTCGAGACCTCA GTCACCTATTACCGGTTGGAGGAGGTGGCAAAGCGCAACTCCTTGAAGGAACTGTGGCTTGTGATCCAT GGGCGAGTCTACGATGTCACCCGCTTCCTCAACGAGCACCCTGGAGGAGAAGAGGTTCTGCTGGAACAA GCTGGTGTAGATGCAAGTGAAAGCTTTGAAGATGTAGGACACTCTTCTGATGCCAGAGAAATGCTAAAG CAGTACTACATTGGTGATATCCATCCGAGTGACCTTAAACCTGAAAGTGGTAGCAAGGACCCTTCAAAA AATGATACATGCAAAAGTTGCTGGGCATATTGGATTTTACCCATCATAGGCGCTGTTCTCTTAGGTTTC CTGTACCGCTACTACACATCGGAAAGCAAATCCTCCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_030579 |
Insert Size | 453 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_030579.2 |
RefSeq Size | 4286 bp |
RefSeq ORF | 453 bp |
Locus ID | 80777 |
UniProt ID | O43169 |
Domains | heme_1 |
Protein Families | Transmembrane |
MW | 16.7 kDa |
Gene Summary | Cytochrome b5 is a membrane-bound hemoprotein functioning as an electron carrier for several membrane-bound oxygenases.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC200604 | CYB5B (Myc-DDK-tagged)-Human cytochrome b5 type B (outer mitochondrial membrane) (CYB5B), nuclear gene encoding mitochondrial protein |
CNY 1,200.00 |
|
RC200604L1 | Lenti ORF clone of Human cytochrome b5 type B (outer mitochondrial membrane) (CYB5B), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
CNY 3,600.00 |
|
RC200604L2 | Lenti ORF clone of Human cytochrome b5 type B (outer mitochondrial membrane) (CYB5B), nuclear gene encoding mitochondrial protein, mGFP tagged |
CNY 5,890.00 |
|
RC200604L3 | Lenti ORF clone of Human cytochrome b5 type B (outer mitochondrial membrane) (CYB5B), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC200604L4 | Lenti ORF clone of Human cytochrome b5 type B (outer mitochondrial membrane) (CYB5B), nuclear gene encoding mitochondrial protein, mGFP tagged |
CNY 5,890.00 |
|
RG200604 | CYB5B (tGFP-tagged) - Human cytochrome b5 type B (outer mitochondrial membrane) (CYB5B), nuclear gene encoding mitochondrial protein |
CNY 2,800.00 |
|
SC107995 | CYB5B (untagged)-Human cytochrome b5 type B (outer mitochondrial membrane) (CYB5B), nuclear gene encoding mitochondrial protein |
CNY 1,200.00 |
其它Cytochrome b5 Outer Mitochondrial Membrane产品