ZNF593 (NM_015871) Human Untagged Clone
CAT#: SC317235
ZNF593 (untagged)-Human zinc finger protein 593 (ZNF593)
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ZT86 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC317235 representing NM_015871.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGTCGCTCCCGCCGGACAGGCGCGCACCGAGCGCACTCTCTAGCCCGGCAGATGAAGGCGAAGCGG CGGCGGCCGGACTTGGATGAGATTCACCGCGAGCTGCGGCCTCAGGGATCCGCACGACCCCAGCCCGAC CCAAACGCCGAGTTCGACCCCGACCTGCCAGGGGGCGGTCTGCACCGCTGTCTGGCCTGCGCGAGGTAC TTCATCGATTCCACCAACCTGAAGACCCACTTCCGATCCAAAGACCACAAGAAAAGGCTGAAGCAGCTG AGCGTCGAGCCCTACAGTCAGGAAGAGGCGGAGAGGGCAGCGGGTATGGGATCCTATGTGCCCCCCAGG CGGCTGGCAGTGCCCACGGAAGTGTCCACTGAGGTCCCTGAGATGGATACCTCTACCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_015871 |
Insert Size | 405 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_015871.4 |
RefSeq Size | 653 bp |
RefSeq ORF | 405 bp |
Locus ID | 51042 |
UniProt ID | O00488 |
Protein Families | Stem cell - Pluripotency, Transcription Factors |
MW | 15.2 kDa |
Gene Summary | Negatively modulates the DNA binding activity of Oct-2 and therefore its transcriptional regulatory activity. Could act either by binding to DNA octamer or by interacting with Oct-2. May also be a modulator of other octamer-binding proteins.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC201028 | ZNF593 (Myc-DDK-tagged)-Human zinc finger protein 593 (ZNF593) |
CNY 1,200.00 |
|
RC201028L3 | Lenti ORF clone of Human zinc finger protein 593 (ZNF593), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC201028L4 | Lenti ORF clone of Human zinc finger protein 593 (ZNF593), mGFP tagged |
CNY 5,890.00 |
|
RG201028 | ZNF593 (tGFP-tagged) - Human zinc finger protein 593 (ZNF593) |
CNY 2,800.00 |
|
SC108174 | ZNF593 (untagged)-Human zinc finger protein 593 (ZNF593) |
CNY 1,200.00 |