NDUFB1 (NM_004545) Human Untagged Clone
CAT#: SC317226
NDUFB1 (untagged)-Human NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 1, 7kDa (NDUFB1), nuclear gene encoding mitochondrial protein
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CI-MNLL; CI-SGDH; MNLL |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC317226 representing NM_004545.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGATTTGCTGGCGTCACCCCTCTGCTCCGTGCGGGCGCGGCGAATGGCAGGTCCCGAGGTCGCAGCTT CCACTGGCGCGGGTTGAGTTCCCTGTTGCCCTTGGTCTCGGGGTCGCTGTAGGCGCTGAGGCTGCAGCT ATCATGGTGAACTTACTTCAGATTGTGCGGGACCACTGGGTTCATGTTCTTGTCCCTATGGGATTTGTC ATTGGATGTTATTTAGACAGAAAGAGTGATGAACGGCTAACTGCCTTCCGGAACAAGAGTATGTTATTT AAAAGGGAATTGCAACCCAGTGAAGAAGTTACCTGGAAGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_004545 |
Insert Size | 318 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_004545.3 |
RefSeq Size | 433 bp |
RefSeq ORF | 318 bp |
Locus ID | 4707 |
UniProt ID | O75438 |
Protein Families | Transmembrane |
Protein Pathways | Alzheimer's disease, Huntington's disease, Metabolic pathways, Oxidative phosphorylation, Parkinson's disease |
MW | 11.9 kDa |
Gene Summary | Accessory subunit of the mitochondrial membrane respiratory chain NADH dehydrogenase (Complex I) that is believed not to be involved in catalysis. Complex I functions in the transfer of electrons from NADH to the respiratory chain. The immediate electron acceptor for the enzyme is believed to be ubiquinone.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC224571 | NDUFB1 (Myc-DDK-tagged)-Human NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 1, 7kDa (NDUFB1), nuclear gene encoding mitochondrial protein |
CNY 1,200.00 |
|
RC224571L3 | Lenti ORF clone of Human NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 1, 7kDa (NDUFB1), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC224571L4 | Lenti ORF clone of Human NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 1, 7kDa (NDUFB1), nuclear gene encoding mitochondrial protein, mGFP tagged |
CNY 5,890.00 |
|
RG224571 | NDUFB1 (tGFP-tagged) - Human NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 1, 7kDa (NDUFB1), nuclear gene encoding mitochondrial protein |
CNY 2,800.00 |
|
SC117332 | NDUFB1 (untagged)-Human NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 1, 7kDa (NDUFB1), nuclear gene encoding mitochondrial protein |
CNY 1,200.00 |