United States
Germany
Japan
United Kingdom
China
ZP3 (NM_001110354) Human Untagged Clone
CAT＃: SC317200
ZP3 (untagged)-Human zona pellucida glycoprotein 3 (sperm receptor) (ZP3), transcript variant 1
CNY 3,656.00
CNY 6,840.00
Product images
热销推荐Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | OOMD3; Zp-3; ZP3A; ZP3B; ZPC |
| Vector | pCMV6-XL4 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_001110354 edited
ATGGAGCTGAGCTATAGGCTCTTCATCTGCCTCCTGCTCTGGGGTAGTACTGAGCTGTGC TACCCCCAACCCCTCTGGCTCTTGCAGGGTGGAGCCAGCCATCCTGAGACGTCCGTACAG CCCGTACTGGTGGAGTGTCAGGAGGCCACTCTGATGGTCATGGTCAGCAAAGACCTTTTT GGCACCGGGAAGCTCATCAGGGCTGCTGACCTCACCTTGGGCCCAGAGGCCTGTGAGCCT CTGGTCTCCATGGACACAGAAGATGTGGTCAGGTTTGAGGTTGGACTCCACGAGTGTGGC AACAGCATGCAGGTAACTGACGATGCCCTGGTGTACAGCACCTTCCTGCTCCATGACCCC CGCCCCGTGGGAAACCTGTCCATCGTGAGGACTAACCGCGCAGAGATTCCCATCGAGTGC CGCTACCCCAGGCAGGGCAATGTGAGCAGCCAGGCCATCCTGCCCACCTGGTTGCCCTTC AGGACCACGGTGTTCTCAGAGGAGAAGCTGACTTTCTCTCTGCGTCTGATGGAGGAGAAC TGGAACGCTGAGAAGAGGTCCCCCACCTTCCACCTGGGAGATGCAGCCCACCTCCAGGCA GAAATCCACACTGGCAGCCACGTGCCACTGCGGTTGTTTGTGGACCACTGCGTGGCCACA CCGACACCAGACCAGAATGCCTCCCCTTATCACACCATCGTGGACTTCCATGGCTGTCTT GTCGACGGTCTCACTGATGCCTCTTCTGCATTCAAAGTTCCTCGACCCGGGCCAGATACA CTCCAGTTCACAGTGGATGTCTTCCACTTTGCTAATGACTCCAGAAACATGATATACATC ACCTGCCACCTGAAGGTCACCCTAGCTGAGCAGGACCCAGATGAACTCAACAAGGCCTGT TCCTTCAGCAAGCCTTCCAACAGCTGGTTCCCAGTGGAAGGCTCGGCTGACATCTGTCAA TGCTGTAACAAAGGTGACTGTGGCACTCCAAGCCATTCCAGGAGGCAGCCTCATGTCATG AGCCAGTGGTCCAGGTCTGCTTCCCGTAACCGCAGGCATGTGACAGAAGAAGCAGATGTC ACCGTGGGGCCACTGATCTTCCTGGACAGGAGGGGTGACCATGAAGTAGAGCAGTGGGCT TTGCCTTCTGACACCTCAGTGGTGCTGCTGGGCGTAGGCCTGGCTGTGGTGGTGTCCCTG ACTCTGACTGCTGTTATCCTGGTTCTCACCAGGAGGTGTCGCACTGCCTCCCACCCTGTG TCTGCTTCCGAATAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001110354 |
| Insert Size | 1400 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001110354.1, NP_001103824.1 |
| RefSeq Size | 1317 bp |
| RefSeq ORF | 1275 bp |
| Locus ID | 7784 |
| UniProt ID | P21754 |
| Protein Families | Secreted Protein, Transmembrane |
| Gene Summary | The zona pellucida is an extracellular matrix that surrounds the oocyte and early embryo. It is composed primarily of three or four glycoproteins with various functions during fertilization and preimplantation development. The protein encoded by this gene is a structural component of the zona pellucida and functions in primary binding and induction of the sperm acrosome reaction. The nascent protein contains a N-terminal signal peptide sequence, a conserved ZP domain, a C-terminal consensus furin cleavage site, and a transmembrane domain. It is hypothesized that furin cleavage results in release of the mature protein from the plasma membrane for subsequent incorporation into the zona pellucida matrix. However, the requirement for furin cleavage in this process remains controversial based on mouse studies. A variation in the last exon of this gene has previously served as the basis for an additional ZP3 locus; however, sequence and literature review reveals that there is only one full-length ZP3 locus in the human genome. Another locus encoding a bipartite transcript designated POMZP3 contains a duplication of the last four exons of ZP3, including the above described variation, and maps closely to this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) encodes the longer isoform (1). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC225686 | ZP3 (Myc-DDK-tagged)-Human zona pellucida glycoprotein 3 (sperm receptor) (ZP3), transcript variant 1 |
CNY 3,656.00 |
|
| RC225686L3 | Lenti ORF clone of Human zona pellucida glycoprotein 3 (sperm receptor) (ZP3), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC225686L4 | Lenti ORF clone of Human zona pellucida glycoprotein 3 (sperm receptor) (ZP3), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RG225686 | ZP3 (tGFP-tagged) - Human zona pellucida glycoprotein 3 (sperm receptor) (ZP3), transcript variant 1 |
CNY 5,256.00 |
