Cyclin A1 (CCNA1) (NM_001111047) Human Untagged Clone

CAT#: SC317199

CCNA1 (untagged)-Human cyclin A1 (CCNA1), transcript variant 4



  "NM_001111047" in other vectors (4)

CNY 7,220.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal anti-Cyclin A antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CT146
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001111047, the custom clone sequence may differ by one or more nucleotides
ATGCACTGCAGCAACCCCAAGAGTGGAGTTGTGCTGGCTACAGTGGCCCGAGGTCCCGAT
GCTTGTCAGATACTCACCAGAGCCCCGCTGGGCCAGGATCCCCCGCAGAGGACAGTGCTA
GGGCTGCTAACTGCAAATGGGCAGTACAGGAGGACCTGTGGCCAGGGGATCACAAGAATC
AGGTGTTATTCTGGATCAGAAAATGCCTTCCCTCCAGCTGGAAAGAAAGCACTCCCTGAC
TGTGGGGTCCAAGAGCCCCCCAAGCAAGGGTTTGACATCTACATGGATGAACTAGAGCAG
GGGGACAGAGACAGCTGCTCGGTCAGAGAGGGGATGGCATTTGAGGATGTGTATGAAGTA
GACACCGGCACACTCAAGTCAGACCTGCACTTCCTGCTGGATTTCAACACAGTTTCCCCT
ATGCTGGTAGATTCATCTCTCCTCTCCCAGTCTGAAGATATATCCAGTCTTGGCACAGAT
GTGATAAATGTGACTGAATATGCTGAAGAAATTTATCAGTACCTTAGGGAAGCTGAAATA
AGGCACAGACCCAAAGCACACTACATGAAGAAGCAGCCAGACATCACGGAAGGCATGCGC
ACGATTCTGGTGGACTGGCTGGTGGAGGTTGGGGAAGAATATAAACTTCGAGCAGAGACC
CTGTATCTGGCTGTCAACTTCCTGGACAGGTTCCTTTCATGTATGTCTGTTCTGAGAGGG
AAACTGCAGCTCGTAGGAACAGCAGCTATGCTTTTGGCTTCGAAATATGAAGAGATATAT
CCTCCTGAAGTAGACGAGTTTGTCTATATCACCGATGATACATACACAAAACGACAACTG
TTAAAAATGGAACACTTGCTTCTGAAAGTTCTAGCTTTTGATCTGACAGTACCAACCACC
AACCAGTTTCTCCTTCAGTACTTGAGGCGACAAGGAGTGTGCGTCAGGACTGAGAACCTG
GCTAAGTACGTAGCAGAGCTGAGTCTACTTGAAGCAGATCCATTCTTGAAATATCTTCCT
TCACTGATAGCTGCAGCAGCTTTTTGCCTGGCAAACTATACTGTGAACAAGCACTTTTGG
CCAGAAACCCTTGCTGCATTTACAGGGTATTCATTAAGTGAAATTGTGCCTTGCCTGAGT
GAGCTTCATAAAGCGTACCTTGATATACCCCATCGACCTCAGCAAGCAATTAGGGAGAAG
TACAAGGCTTCAAAGTACCTGTGTGTGTCCCTCATGGAGCCACCTGCAGTTCTTCTTCTA
CAA
Restriction Sites Please inquire     
ACCN NM_001111047
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001111047.1, NP_001104517.1
RefSeq Size 1841 bp
RefSeq ORF 1266 bp
Locus ID 8900
UniProt ID P78396
Protein Families Druggable Genome
Protein Pathways Acute myeloid leukemia, Cell cycle, Pathways in cancer, Progesterone-mediated oocyte maturation
Gene Summary The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. The cyclin encoded by this gene was shown to be expressed in testis and brain, as well as in several leukemic cell lines, and is thought to primarily function in the control of the germline meiotic cell cycle. This cyclin binds both CDK2 and CDC2 kinases, which give two distinct kinase activities, one appearing in S phase, the other in G2, and thus regulate separate functions in cell cycle. This cyclin was found to bind to important cell cycle regulators, such as Rb family proteins, transcription factor E2F-1, and the p21 family proteins. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (4) contains a distinct 5' UTR, lacks an in-frame portion of the 5' coding region, and uses an alternate in-frame splice site in the 5' coding region, compared to variant 1. Transcript variants 3 and 4 encode isoform c, which has a shorter N-terminus when compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...