United States
Germany
Japan
United Kingdom
China
CLDN25 (NM_001101389) Human Untagged Clone
CAT＃: SC317042
CLDN25 (untagged)-Human claudin 25 (CLDN25)
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_001101389 edited
GCCACCATGGCCTGGAGTTTCCGTGCAAAAGTCCAGCTCGGGGGGCTACTTCTCTCCCTC CTTGGCTGGGTCTGCTCCTGTGTTACCACCATCCTGCCCCAGTGGAAGACTCTTAATCTG GAACTGAACGAGATGGAGACCTGGATCATGGGGATTTGGGAGGTCTGCGTGGATCGAGAG GAAGTCGCCACTGTGTGCAAGGCCTTTGAATCCTTCTTGTCTCTGCCCCAGGAGCTCCAG GTAGCCCGCATCCTCATGGTAGCCTCCCATGGGCTGGGCCTATTGGGGCTTTTGCTCTGC AGCTTTGGGTCTGAATGCTTCCAGTTTCACAGGATCAGATGGGTATTCAAGAGGCGGCTT GGTCTCCTGGGAAGGACTTTGGAGGCATCCGCTTCAGCCACTACCCTCCTTCCAGTCTCC TGGGTGGCCCATGCCACAATCCAAGACTTCTGGGATGACAGCATCCCTGACATCATACCT CGGTGGGAGTTTGGAGGTGCCCTCTACTTGGGCTGGGCTGCTGGTATTTTCCTGGCTCTT GGTGGGCTACTCCTCATCTTCTCGGCCTGCCTGGGAAAAGAAGATGTGCCTTTTCCTTTG ATGGCTGGTCCCACAGTCCCCCTATCCTGTGCTCCAGTGGAGGAGTCAGATGGCTCCTTC CACCTCATGCTAAGACCTAGGAACCTGGTCATCTAG |
| Restriction Sites | Please inquire |
| ACCN | NM_001101389 |
| Insert Size | 700 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001101389.1, NP_001094859.1 |
| RefSeq Size | 690 bp |
| RefSeq ORF | 690 bp |
| Locus ID | 644672 |
| UniProt ID | C9JDP6 |
| Gene Summary | This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. [provided by RefSeq, Jun 2010] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC225286 | CLDN25 (Myc-DDK-tagged)-Human claudin 25 (CLDN25) |
CNY 2,400.00 |
|
| RC225286L3 | Lenti ORF clone of Human claudin 25 (CLDN25), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC225286L4 | Lenti ORF clone of Human claudin 25 (CLDN25), mGFP tagged |
CNY 5,890.00 |
|
| RG225286 | CLDN25 (tGFP-tagged) - Human claudin 25 (CLDN25) |
CNY 4,370.00 |
