ZFAND5 (NM_001102420) Human Untagged Clone
CAT#: SC316909
ZFAND5 (untagged)-Human zinc finger, AN1-type domain 5 (ZFAND5), transcript variant a
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ZA20D2; ZFAND5A; ZNF216 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC316909 representing NM_001102420.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCTCAGGAGACTAACCAGACCCCGGGGCCCATGCTGTGTAGCACAGGATGTGGCTTTTATGGAAAT CCTAGGACAAATGGAATGTGTTCAGTTTGCTACAAAGAACATCTTCAGAGGCAGCAAAATAGTGGCAGA ATGAGCCCAATGGGGACAGCTAGTGGTTCCAACAGTCCTACCTCAGATTCTGCATCTGTACAGAGAGCA GACACTAGCTTAAACAACTGTGAAGGTGCTGCTGGCAGCACATCTGAAAAATCAAGAAATGTGCCTGTG GCTGCCTTGCCTGTAACTCAGCAAATGACAGAAATGAGCATTTCAAGAGAGGACAAAATAACTACCCCG AAAACAGAGGTGTCAGAGCCAGTTGTCACTCAGCCCAGTCCATCAGTTTCTCAGCCCAGTACTTCTCAG AGTGAAGAAAAAGCTCCTGAATTGCCCAAACCAAAGAAAAACAGATGTTTCATGTGCAGAAAGAAAGTT GGTCTTACAGGGTTTGACTGCCGATGTGGAAATTTGTTTTGTGGACTTCACCGTTACTCTGACAAGCAC AACTGTCCGTATGATTACAAAGCAGAAGCTGCAGCAAAAATCAGAAAAGAGAATCCAGTTGTTGTGGCT GAAAAAATTCAGAGAATATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001102420 |
Insert Size | 642 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001102420.2 |
RefSeq Size | 5887 bp |
RefSeq ORF | 642 bp |
Locus ID | 7763 |
UniProt ID | O76080 |
MW | 23.1 kDa |
Gene Summary | Involved in protein degradation via the ubiquitin-proteasome system. May act by anchoring ubiquitinated proteins to the proteasome. Plays a role in ubiquitin-mediated protein degradation during muscle atrophy. Plays a role in the regulation of NF-kappa-B activation and apoptosis. Inhibits NF-kappa-B activation triggered by overexpression of RIPK1 and TRAF6 but not of RELA. Inhibits also tumor necrosis factor (TNF), IL-1 and TLR4-induced NF-kappa-B activation in a dose-dependent manner. Overexpression sensitizes cells to TNF-induced apoptosis. Is a potent inhibitory factor for osteoclast differentiation.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (a) represents the longest transcript. All six variants encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC221072 | ZFAND5 (Myc-DDK-tagged)-Human zinc finger, AN1-type domain 5 (ZFAND5), transcript variant a |
CNY 2,400.00 |
|
RC221072L3 | Lenti ORF clone of Human zinc finger, AN1-type domain 5 (ZFAND5), transcript variant a, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC221072L4 | Lenti ORF clone of Human zinc finger, AN1-type domain 5 (ZFAND5), transcript variant a, mGFP tagged |
CNY 5,890.00 |
|
RG221072 | ZFAND5 (tGFP-tagged) - Human zinc finger, AN1-type domain 5 (ZFAND5), transcript variant a |
CNY 4,370.00 |