RGS8 (NM_001102450) Human Untagged Clone

CAT#: SC316903

RGS8 (untagged)-Human regulator of G-protein signaling 8 (RGS8), transcript variant 2



  "NM_001102450" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
RGS8 Antibody - N-terminal region
    • 50 ug

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC316903 representing NM_001102450.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCGGCCTTACTGATGCCACGCAGGAACAAAGGGATGAGGACTCGACTGGGATGCCTGTCTCACAAG
TCAGACTCGTGTAGTGATTTCACAGCTATTCTTCCAGACAAACCCAACCGCGCTCTCAAGAGATTATCG
ACAGAAGAAGCTACGAGGTGGGCAGATTCCTTTGATGTGCTTCTCTCTCATAAGTATGGGGTGGCTGCA
TTCCGTGCCTTCTTGAAGACGGAGTTCAGTGAGGAGAACCTGGAATTCTGGTTGGCCTGTGAGGAGTTC
AAGAAGACCAGGTCAACTGCAAAACTGGTCTCTAAGGCCCATAGGATCTTTGAGGAGTTTGTGGATGTG
CAGGCTCCACGGGAGGTAAACATTGACTTCCAGACCCGAGAAGCCACGAGGAAGAACCTGCAGGAGCCA
TCCCTGACTTGCTTTGACCAAGCCCAAGGAAAAGTACACAGCCTCATGGAGAAAGACTCTTACCCCAGG
TTCCTGAGGTCCAAAATGTACTTAGATCTGCTGTCCCAAAGCCAGAGGAGGCTCAGTTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001102450
Insert Size 543 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001102450.2
RefSeq Size 5774 bp
RefSeq ORF 543 bp
Locus ID 85397
UniProt ID P57771
Protein Families Druggable Genome
MW 20.9 kDa
Gene Summary This gene is a member of the regulator of G protein signaling (RGS) family and encodes a protein with a single RGS domain. Regulator of G protein signaling (RGS) proteins are regulatory and structural components of G protein-coupled receptor complexes. They accelerate transit through the cycle of GTP binding and hydrolysis to GDP, thereby terminating signal transduction, but paradoxically, also accelerate receptor-stimulated activation. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) has an additional exon in the 5' region, which results in an alternate 5' coding sequence, as compared to variant 1. The resulting isoform (2) has a shorter and alternate N-terminus, as compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...