United States
Germany
Japan
United Kingdom
China
CXCL16 (NM_001100812) Human Untagged Clone
CAT＃: SC316700
CXCL16 (untagged)-Human chemokine (C-X-C motif) ligand 16 (CXCL16), transcript variant 2
CNY 6,270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CXCLG16; SR-PSOX; SRPSOX |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC316700 representing NM_001100812.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCTGGGAGTCAGAGCGAGGTGGCTCCATCCCCGCAGAGTCCGCGGAGCCCCGAGATGGGACGGGAC TTGCGGCCCGGGTCCCGCGTGCTCCTGCTCCTGCTTCTGCTCCTGCTGGTGTACCTGACTCAGCCAGGC AATGGCAACGAGGGCAGCGTCACTGGAAGTTGTTATTGTGGTAAAAGAATTTCTTCCGACTCCCCGCCA TCGGTTCAGTTCATGAATCGTCTCCGGAAACACCTGAGAGCTTACCATCGGTGTCTATACTACACGAGG TTCCAGCTCCTTTCCTGGAGCGTGTGTGGGGGCAACAAGGACCCATGGGTTCAGGAATTGATGAGCTGT CTTGATCTCAAAGAATGTGGACATGCTTACTCGGGGATTGTGGCCCACCAGAAGCATTTACTTCCTACC AGCCCCCCAATTTCTCAGGCCTCAGAGGGGGCATCTTCAGATATCCACACCCCTGCCCAGATGCTCCTG TCCACCTTGCAGTCCACTCAGCGCCCCACCCTCCCAGTAGGATCACTGTCCTCGGACAAAGAGCTCACT CGTCCCAATGAAACCACCATTCACACTGCGGGCCACAGTCTGGCAGCTGGGCCTGAGGCTGGGGAGAAC CAGAAGCAGCCGGAAAAAAATGCTGGTCCCACAGCCAGGACATCAGCCACAGTGCCAGTCCTGTGCCTC CTGGCCATCATCTTCATCCTCACCGCAGCCCTTTCCTATGTGCTGTGCAAGAGGAGGAGGGGGCAGTCA CCGCAGTCCTCTCCAGATCTGCCGGTTCATTATATACCTGTGGCACCTGACTCTAATACCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001100812 |
| Insert Size | 822 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001100812.1 |
| RefSeq Size | 1466 bp |
| RefSeq ORF | 822 bp |
| Locus ID | 58191 |
| UniProt ID | Q9H2A7 |
| Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
| Protein Pathways | Chemokine signaling pathway, Cytokine-cytokine receptor interaction |
| MW | 29.5 kDa |
| Gene Summary | Acts as a scavenger receptor on macrophages, which specifically binds to OxLDL (oxidized low density lipoprotein), suggesting that it may be involved in pathophysiology such as atherogenesis (By similarity). Induces a strong chemotactic response. Induces calcium mobilization. Binds to CXCR6/Bonzo.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) includes a 3' terminal exon that extends past a splice site that is used in variant 1. This results in a novel 3' UTR compared to variant 1. Variants 1 and 2 encode the same protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC218494 | CXCL16 (Myc-DDK-tagged)-Human chemokine (C-X-C motif) ligand 16 (CXCL16), transcript variant 2 |
CNY 3,600.00 |
|
| RC218494L1 | Lenti ORF clone of Human chemokine (C-X-C motif) ligand 16 (CXCL16), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC218494L2 | Lenti ORF clone of Human chemokine (C-X-C motif) ligand 16 (CXCL16), transcript variant 2, mGFP tagged |
CNY 6,000.00 |
|
| RC218494L3 | Lenti ORF clone of Human chemokine (C-X-C motif) ligand 16 (CXCL16), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC218494L4 | Lenti ORF clone of Human chemokine (C-X-C motif) ligand 16 (CXCL16), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG218494 | CXCL16 (tGFP-tagged) - Human chemokine (C-X-C motif) ligand 16 (CXCL16), transcript variant 2 |
CNY 4,370.00 |
