MMD2 (NM_001100600) Human Untagged Clone
CAT#: SC316697
MMD2 (untagged)-Human monocyte to macrophage differentiation-associated 2 (MMD2), transcript variant 1
CNY 2,400.00
CNY 6,270.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | PAQR10 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC316697 representing NM_001100600.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTTCGCCCCCCGGCTGCTGGATTTCCAGAAGACGAAATACGCGAGGTTCATGAACCACCGAGTCCCT GCCCACAAGAGGTACCAGCCCACAGAGTATGAACATGCGGCCAACTGTGCCACCCATGCTTTCTGGATC ATCCCCAGCATCCTGGGCAGCTCCAACCTCTACTTCCTGTCGGACGATGACTGGGAGACCATCTCTGCC TGGATCTACGGCCTCGGCCTCTGCGGCCTCTTCGTGGTGTCCACTGTGTTTCACACCATCTCCTGGAAG AAGAGCCACCTCAGGATGGTGGAACACTGTCTACACATGTTCGACCGGATGGTCATCTATTTCTTCATA GCGGCTTCCTACGCACCCTGGCTGAACCTTCGGGAGCTGGGCCCCTGGGCCTCCCACATGCGCTGGCTG GTCTGGATTATGGCTTCCGTGGGCACCATCTATGTCTTCTTCTTCCATGAGCGAACAGGGAGCTGTGTG CAGTTTCTTCGTGGGGAGGCATGTCCTAAGGCCGGCACGGCTTGTCTTCCTGCCAGGTACAAGCTTGTG GAGCTTCTCTGCTACGTCGTAATGGGCTTCTTCCCCGCCCTGGTCATCCTCTCCATGCCCAACACCGAG GGCATCTGGGAGCTGGTGACCGGAGGGGTCTTCTACTGCCTGGGCATGGTCTTCTTCAAGAGTGACGGG AGGATCCCCTTTGCCCACGCCATCTGGCATCTCTTTGTAGCATTTGGTGCTGGTACCCACTACTATGCC ATCTGGAGGTACCTCTATCTGCCCAGCACCCTGCAGACCAAGGTGTCCAAATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001100600 |
Insert Size | 813 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001100600.1 |
RefSeq Size | 2434 bp |
RefSeq ORF | 813 bp |
Locus ID | 221938 |
UniProt ID | Q8IY49 |
Protein Families | Druggable Genome, Transmembrane |
MW | 31.3 kDa |
Gene Summary | This gene encodes a member of the PAQR (progestin and adipoQ receptor) family. Members of this family are evolutionarily conserved with significant sequence identity to bacterial hemolysin-like proteins and are defined by a set of seven transmembrane domains. The protein encoded by this gene localizes to the Golgi apparatus to modulate Ras signaling. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jun 2012] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC216026 | MMD2 (Myc-DDK-tagged)-Human monocyte to macrophage differentiation-associated 2 (MMD2), transcript variant 1 |
CNY 2,400.00 |
|
RC216026L1 | Lenti ORF clone of Human monocyte to macrophage differentiation-associated 2 (MMD2), transcript variant 1, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC216026L2 | Lenti ORF clone of Human monocyte to macrophage differentiation-associated 2 (MMD2), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC216026L3 | Lenti ORF clone of Human monocyte to macrophage differentiation-associated 2 (MMD2), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC216026L4 | Lenti ORF clone of Human monocyte to macrophage differentiation-associated 2 (MMD2), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG216026 | MMD2 (tGFP-tagged) - Human monocyte to macrophage differentiation-associated 2 (MMD2), transcript variant 1 |
CNY 4,370.00 |