MMD2 (NM_001100600) Human Untagged Clone

CAT#: SC316697

MMD2 (untagged)-Human monocyte to macrophage differentiation-associated 2 (MMD2), transcript variant 1



  "NM_001100600" in other vectors (6)

CNY 2,400.00

CNY 6,270.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-MMD2 Antibody
    • 100 ul

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PAQR10
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC316697 representing NM_001100600.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTTCGCCCCCCGGCTGCTGGATTTCCAGAAGACGAAATACGCGAGGTTCATGAACCACCGAGTCCCT
GCCCACAAGAGGTACCAGCCCACAGAGTATGAACATGCGGCCAACTGTGCCACCCATGCTTTCTGGATC
ATCCCCAGCATCCTGGGCAGCTCCAACCTCTACTTCCTGTCGGACGATGACTGGGAGACCATCTCTGCC
TGGATCTACGGCCTCGGCCTCTGCGGCCTCTTCGTGGTGTCCACTGTGTTTCACACCATCTCCTGGAAG
AAGAGCCACCTCAGGATGGTGGAACACTGTCTACACATGTTCGACCGGATGGTCATCTATTTCTTCATA
GCGGCTTCCTACGCACCCTGGCTGAACCTTCGGGAGCTGGGCCCCTGGGCCTCCCACATGCGCTGGCTG
GTCTGGATTATGGCTTCCGTGGGCACCATCTATGTCTTCTTCTTCCATGAGCGAACAGGGAGCTGTGTG
CAGTTTCTTCGTGGGGAGGCATGTCCTAAGGCCGGCACGGCTTGTCTTCCTGCCAGGTACAAGCTTGTG
GAGCTTCTCTGCTACGTCGTAATGGGCTTCTTCCCCGCCCTGGTCATCCTCTCCATGCCCAACACCGAG
GGCATCTGGGAGCTGGTGACCGGAGGGGTCTTCTACTGCCTGGGCATGGTCTTCTTCAAGAGTGACGGG
AGGATCCCCTTTGCCCACGCCATCTGGCATCTCTTTGTAGCATTTGGTGCTGGTACCCACTACTATGCC
ATCTGGAGGTACCTCTATCTGCCCAGCACCCTGCAGACCAAGGTGTCCAAATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001100600
Insert Size 813 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001100600.1
RefSeq Size 2434 bp
RefSeq ORF 813 bp
Locus ID 221938
UniProt ID Q8IY49
Protein Families Druggable Genome, Transmembrane
MW 31.3 kDa
Gene Summary This gene encodes a member of the PAQR (progestin and adipoQ receptor) family. Members of this family are evolutionarily conserved with significant sequence identity to bacterial hemolysin-like proteins and are defined by a set of seven transmembrane domains. The protein encoded by this gene localizes to the Golgi apparatus to modulate Ras signaling. Alternative splicing results in multiple transcript variants and protein isoforms. [provided by RefSeq, Jun 2012]
Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...