CRSP9 (MED7) (NM_001100816) Human Untagged Clone
CAT#: SC316688
MED7 (untagged)-Human mediator complex subunit 7 (MED7), transcript variant 1
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ARC34; CRSP9; CRSP33 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC316688 representing NM_001100816.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGTGAACCACAGCAAGTGAGTGCACTTCCACCACCTCCAATGCAATATATCAAGGAATATACGGAT GAAAATATTCAAGAAGGCTTAGCTCCCAAGCCTCCCCCTCCAATAAAAGACAGTTACATGATGTTTGGC AATCAGTTCCAATGTGATGATCTTATCATCCGCCCTTTGGAAAGTCAGGGCATCGAACGGCTTCATCCT ATGCAGTTTGATCACAAGAAAGAACTGAGAAAACTTAATATGTCTATCCTTATTAATTTCTTGGACCTT TTAGATATTTTAATAAGGAGCCCTGGGAGTATAAAACGAGAAGAGAAACTAGAAGATCTTAAGCTGCTT TTTGTACACGTGCATCATCTTATAAATGAATACCGACCCCACCAAGCAAGAGAGACCTTGAGAGTCATG ATGGAGGTCCAGAAACGTCAACGGCTTGAAACAGCTGAGAGATTTCAAAAGCACCTGGAACGAGTAATT GAAATGATTCAGAATTGCTTGGCTTCTTTGCCTGATGATTTGCCTCATTCAGAAGCAGGAATGAGAGTA AAAACTGAACCAATGGATGCTGATGATAGCAACAATTGTACTGGACAGAATGAACATCAAAGAGAAAAT TCAGGTCATAGGAGAGATCAGATTATAGAGAAAGATGCTGCCTTGTGTGTCCTAATTGATGAGATGAAT GAAAGACCATGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001100816 |
Insert Size | 702 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001100816.1 |
RefSeq Size | 1400 bp |
RefSeq ORF | 702 bp |
Locus ID | 9443 |
UniProt ID | O43513 |
Protein Families | Druggable Genome, Transcription Factors |
MW | 27.2 kDa |
Gene Summary | The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) represents the longer transcript. Both variants encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212508 | MED7 (Myc-DDK-tagged)-Human mediator complex subunit 7 (MED7), transcript variant 1 |
CNY 2,400.00 |
|
RC212508L3 | Lenti ORF clone of Human mediator complex subunit 7 (MED7), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC212508L4 | Lenti ORF clone of Human mediator complex subunit 7 (MED7), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG212508 | MED7 (tGFP-tagged) - Human mediator complex subunit 7 (MED7), transcript variant 1 |
CNY 4,370.00 |