CRSP9 (MED7) (NM_001100816) Human Untagged Clone

CAT#: SC316688

MED7 (untagged)-Human mediator complex subunit 7 (MED7), transcript variant 1



  "NM_001100816" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-CRSP9 Antibody
    • 50 ug

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ARC34; CRSP9; CRSP33
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC316688 representing NM_001100816.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGTGAACCACAGCAAGTGAGTGCACTTCCACCACCTCCAATGCAATATATCAAGGAATATACGGAT
GAAAATATTCAAGAAGGCTTAGCTCCCAAGCCTCCCCCTCCAATAAAAGACAGTTACATGATGTTTGGC
AATCAGTTCCAATGTGATGATCTTATCATCCGCCCTTTGGAAAGTCAGGGCATCGAACGGCTTCATCCT
ATGCAGTTTGATCACAAGAAAGAACTGAGAAAACTTAATATGTCTATCCTTATTAATTTCTTGGACCTT
TTAGATATTTTAATAAGGAGCCCTGGGAGTATAAAACGAGAAGAGAAACTAGAAGATCTTAAGCTGCTT
TTTGTACACGTGCATCATCTTATAAATGAATACCGACCCCACCAAGCAAGAGAGACCTTGAGAGTCATG
ATGGAGGTCCAGAAACGTCAACGGCTTGAAACAGCTGAGAGATTTCAAAAGCACCTGGAACGAGTAATT
GAAATGATTCAGAATTGCTTGGCTTCTTTGCCTGATGATTTGCCTCATTCAGAAGCAGGAATGAGAGTA
AAAACTGAACCAATGGATGCTGATGATAGCAACAATTGTACTGGACAGAATGAACATCAAAGAGAAAAT
TCAGGTCATAGGAGAGATCAGATTATAGAGAAAGATGCTGCCTTGTGTGTCCTAATTGATGAGATGAAT
GAAAGACCATGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001100816
Insert Size 702 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001100816.1
RefSeq Size 1400 bp
RefSeq ORF 702 bp
Locus ID 9443
UniProt ID O43513
Protein Families Druggable Genome, Transcription Factors
MW 27.2 kDa
Gene Summary The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1) represents the longer transcript. Both variants encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...