United States
Germany
Japan
United Kingdom
China
PID1 (NM_001100818) Human Untagged Clone
CAT＃: SC316683
PID1 (untagged)-Human phosphotyrosine interaction domain containing 1 (PID1), transcript variant 2
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | HMFN2073; NYGGF4; P-CLI1; PCLI1 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_001100818, the custom clone sequence may differ by one or more nucleotides
ATGTGGCAGCCGGCCACGGAGCGCCTGCAGCACTTTCAGACCATGCTGAAGTCTAAATTGAATGTCTTAA CACTGAAAAAGGAACCTCTCCCAGCGGTCATCTTCCATGAGCCGGAGGCCATTGAGCTGTGCACGACCAC ACCGCTGATGAAGACAAGGACTCACAGTGGCTGCAAGGTTACCTACCTGGGCAAAGTCTCCACCACTGGC ATGCAGTTTTTGTCAGGCTGCACAGAAAAGCCAGTCATTGAGCTCTGGAAGAAGCACACGCTAGCCCGAG AGGATGTCTTTCCGGCCAATGCCCTCCTGGAAATCCGGCCATTCCAAGTTTGGCTCCATCATCTCGACCA CAAAGGGGAGGCCACAGTGCACATGGATACCTTCCAGGTGGCCCGCATCGCCTACTGCACCGCCGACCAC AACGTGAGCCCCAACATCTTCGCCTGGGTCTACAGGGAGATCAATGATGACCTGTCCTACCAGATGGACT GCCACGCCGTGGAGTGCGAGAGCAAGCTCGAGGCCAAGAAACTGGCCCACGCCATGATGGAGGCCTTCAG GAAGACTTTCCACAGTATGAAGAGCGACGGGCGGATCCACAGCAACAGCTCCTCCGAAGAGGTTTCCCAG GAATTGGAATCCGATGATGGCTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_001100818 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001100818.1, NP_001094288.1 |
| RefSeq Size | 2626 bp |
| RefSeq ORF | 654 bp |
| Locus ID | 55022 |
| UniProt ID | Q7Z2X4 |
| Gene Summary | Increases proliferation of preadipocytes without affecting adipocytic differentiation.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks an alternate segment in the 5' coding region and uses an upstream start codon, compared to variant 1. Isoform 2 has a shorter and distinct N-terminus, compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC212505 | PID1 (Myc-DDK-tagged)-Human phosphotyrosine interaction domain containing 1 (PID1), transcript variant 2 |
CNY 2,400.00 |
|
| RC212505L1 | Lenti ORF clone of Human phosphotyrosine interaction domain containing 1 (PID1), transcript variant 2, Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC212505L2 | Lenti ORF clone of Human phosphotyrosine interaction domain containing 1 (PID1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RC212505L3 | Lenti ORF clone of Human phosphotyrosine interaction domain containing 1 (PID1), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC212505L4 | Lenti ORF clone of Human phosphotyrosine interaction domain containing 1 (PID1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG212505 | PID1 (tGFP-tagged) - Human phosphotyrosine interaction domain containing 1 (PID1), transcript variant 2 |
CNY 4,000.00 |
