HIGD1A (NM_001099669) Human Untagged Clone
CAT#: SC316636
HIGD1A (untagged)-Human HIG1 hypoxia inducible domain family, member 1A (HIGD1A), transcript variant 2
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HIG1; RCF1a |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC316636 representing NM_001099669.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCAACAGACACAGGTGTTTCCCTTCCTTCATATGAGGAAGATCAGGGATCAAAACTCATTCGAAAA GCTAAAGAGGCACCATTCGTACCCGTTGGAATAGCGGGTTTTGCAGCAATTGTTGCATATGGATTATAT AAACTGAAGAGCAGGGGAAATACTAAAATGTCCATTCATCTGATCCACATGCGTGTGGCAGCCCAAGGC TTTGTTGTAGGAGCAATGACTGTTGGTATGGGCTATTCCATGTATCGGGAATTCTGGGCAAAACCTAAG CCTTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001099669 |
Insert Size | 282 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001099669.1 |
RefSeq Size | 2805 bp |
RefSeq ORF | 282 bp |
Locus ID | 25994 |
UniProt ID | Q9Y241 |
Protein Families | Transmembrane |
MW | 10.1 kDa |
Gene Summary | Proposed subunit of cytochrome c oxidase (COX, complex IV), which is the terminal component of the mitochondrial respiratory chain that catalyzes the reduction of oxygen to water. May play a role in the assembly of respiratory supercomplexes.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) contains a distinct 5' UTR and lacks a portion of the 5' coding region, compared to variant 1. These differences cause translation initiation at a downstream AUG and a protein (isoform b) with a shorter N-terminus compared to isoform a. Both variants 2 and 3 encode the same protein. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC217271 | HIGD1A (Myc-DDK-tagged)-Human HIG1 hypoxia inducible domain family, member 1A (HIGD1A), transcript variant 2 |
CNY 1,200.00 |
|
RC217271L3 | Lenti ORF clone of Human HIG1 hypoxia inducible domain family, member 1A (HIGD1A), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC217271L4 | Lenti ORF clone of Human HIG1 hypoxia inducible domain family, member 1A (HIGD1A), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG217271 | HIGD1A (tGFP-tagged) - Human HIG1 hypoxia inducible domain family, member 1A (HIGD1A), transcript variant 2 |
CNY 4,370.00 |