CMG1 (IFT74) (NM_001099224) Human Untagged Clone

CAT#: SC316512

IFT74 (untagged)-Human intraflagellar transport 74 homolog (Chlamydomonas) (IFT74), transcript variant 4



  "NM_001099224" in other vectors (4)

CNY 7,220.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-IFT74 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CCDC2; CMG-1; CMG1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001099224, the custom clone sequence may differ by one or more nucleotides
ATGGCCAGCAATCACAAATCTTCAGCAGCTCGCCCTGTTTCAAGAGGTGGAGTTGGGTTA
ACAGGAAGGCCTCCTTCTGGGATACGACCCCTATCAGGAAATATTCGAGTGGCAACTGCA
ATGCCACCTGGGACAGCAAGACCAGGTTCTCGTGGTTGTCCCATAGGGACTGGTGGAGTT
CTGTCTTCTCAAATCAAAGTTGCCCATCGCCCTGTAACACAACAAGGTTTGACTGGAATG
AAAACTGGGACGAAAGGTCCCCAGAGGCAAATTTTAGACAAATCTTACTATCTTGGGCTT
CTTAGAAGTAAAATAAGTGAACTTACAACTGAAGTTAATAAACTTCAGAAGGGAATAGAA
ATGTACAATCAAGAGAATTCAGTATATTTGTCATATGAAAAGAGGGCTGAGACTTTAGCT
GTTGAGATAAAAGAGCTTCAAGGACAACTAGCAGACTACAACATGTTGGTAGATAAACTT
AATACCAACACTGAAATGGAAGAAGTAATGAATGATTACAATATGCTTAAAGCTCAAAAT
GATCGAGAAACACAAAGTTTGGATGTCATATTTACTGAAAGACAAGCGAAAGAAAAACAA
ATCAGAAGTGTCGAAGAAGAAATTGAACAGGAAAAACAAGCAACAGATGACATTATCAAA
AATATGTCTTTTGAAAACCAAGTCAAGTACCTAGAGATGAAAACCACAAATGAGAAACTG
TTACAGGAATTAGATACACTTCAACAACAATTGGATTCACAGAACATGAAAAAAGAGAGC
CTGGAAGCAGAAATAGCTCACTCCCAGGTGAAACAGGAGGCGGTATTGCTGCATGAAAAA
CTTTATGAGTTGGAGTCCCATCGAGATCAAATGATTGCAGAAGACAAAAGCATAGGATCT
CCAATGGAAGAGAGAGAGAAATTACTTAAGCAGATTAAAGATGATAATCAGGAAATAGCC
AGCATGGAAAGACAGTTAACAGATACAAAAGAAAAGATAAATCAGTTTATTGAAGAAATT
AGACAACTTGACATGGATTTAGAGGAACACCAAGATCCTACCAACTATGGATGGAAAATA
CTTGAAAAAAATACAGGAAGTTTCAAAAAGCAAGTT
Restriction Sites Please inquire     
ACCN NM_001099224
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001099224.1, NP_001092694.1
RefSeq Size 1571 bp
RefSeq ORF 1119 bp
Locus ID 80173
UniProt ID Q96LB3
Gene Summary This gene encodes a core intraflagellar transport (IFT) protein which belongs to a multi-protein complex involved in the transport of ciliary proteins along axonemal microtubules. IFT proteins are found at the base of the cilium as well as inside the cilium, where they assemble into long arrays between the ciliary base and tip. This protein, together with intraflagellar transport protein 81, binds and transports tubulin within cilia and is required for ciliogenesis. Naturally occurring mutations in this gene are associated with amyotrophic lateral sclerosis--frontotemporal dementia and Bardet-Biedl Syndrome. [provided by RefSeq, Mar 2017]
Transcript Variant: This variant (4) lacks several exons in the 3' coding region, uses an alternate 3' terminal exon, and differs in the 3' UTR, compared to variant 1. The encoded isoform (b) has a shorter and distinct C-terminus, compared to isoform (a).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...