HLAF (HLA-F) (NM_001098478) Human Untagged Clone

CAT#: SC316351

HLA (untagged)-Human major histocompatibility complex, class I, F (HLA-F), transcript variant 3



  "NM_001098478" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
Rabbit polyclonal Anti-HLA-F Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CDA12; HLA-5.4; HLA-CDA12; HLAF
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001098478, the custom clone sequence may differ by one or more nucleotides
ATGGCGCCCCGAAGCCTCCTCCTGCTGCTCTCAGGGGCCCTGGCCCTGACCGATACTTGG
GCGGGCTCCCACTCCTTGAGGTATTTCAGCACCGCTGTGTCGCGGCCCGGCCGCGGGGAG
CCCCGCTACATCGCCGTGGAGTACGTAGACGACACGCAATTCCTGCGGTTCGACAGCGAC
GCCGCGATTCCGAGGATGGAGCCGCGGGAGCCGTGGGTGGAGCAAGAGGGGCCGCAGTAT
TGGGAGTGGACCACAGGGTACGCCAAGGCCAACGCACAGACTGACCGAGTGGCCCTGAGG
AACCTGCTCCGCCGCTACAACCAGAGCGAGGCTGGGTCTCACACCCTCCAGGGAATGAAT
GGCTGCGACATGGGGCCCGACGGACGCCTCCTCCGCGGGTATCACCAGCACGCGTACGAC
GGCAAGGATTACATCTCCCTGAACGAGGACCTGCGCTCCTGGACCGCGGCGGACACCGTG
GCTCAGATCACCCAGCGCTTCTATGAGGCAGAGGAATATGCAGAGGAGTTCAGGACCTAC
CTGGAGGGCGAGTGCCTGGAGTTGCTCCGCAGATACTTGGAGAATGGGAAGGAGACGCTA
CAGCGCGCAGAGCAGTCTCCCCAGCCCACCATCCCCATCGTGGGCATCGTTGCTGGCCTT
GTTGTCCTTGGAGCTGTGGTCACTGGAGCTGTGGTCGCTGCTGTGATGTGGAGGAAGAAG
AGCTCAGATAGAAACAGAGGGAGCTACTCTCAGGCTGCAGTG
Restriction Sites Please inquire     
ACCN NM_001098478
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001098478.1, NP_001091948.1
RefSeq Size 1025 bp
RefSeq ORF 765 bp
Locus ID 3134
UniProt ID P30511
Protein Families Transmembrane
Protein Pathways Allograft rejection, Antigen processing and presentation, Autoimmune thyroid disease, Cell adhesion molecules (CAMs), Endocytosis, Graft-versus-host disease, Type I diabetes mellitus, Viral myocarditis
Gene Summary This gene belongs to the HLA class I heavy chain paralogues. It encodes a non-classical heavy chain that forms a heterodimer with a beta-2 microglobulin light chain, with the heavy chain anchored in the membrane. Unlike most other HLA heavy chains, this molecule is localized in the endoplasmic reticulum and Golgi apparatus, with a small amount present at the cell surface in some cell types. It contains a divergent peptide-binding groove, and is thought to bind a restricted subset of peptides for immune presentation. This gene exhibits few polymorphisms. Multiple transcript variants encoding different isoforms have been found for this gene. These variants lack a coding exon found in transcripts from other HLA paralogues due to an altered splice acceptor site, resulting in a shorter cytoplasmic domain. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) lacks an alternate in-frame coding exon and uses an alternate 3' exon, compared to variant 1. The resulting isoform (3) is shorter and has a distinct C-terminus, compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...