United States
Germany
Japan
United Kingdom
China
Angiogenin (ANG) (NM_001097577) Human Untagged Clone
CAT＃: SC316135
ANG (untagged)-Human angiogenin, ribonuclease, RNase A family, 5 (ANG), transcript variant 2
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | ALS9; HEL168; RAA1; RNASE4; RNASE5 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC316135 representing NM_001097577.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGTGATGGGCCTGGGCGTTTTGTTGTTGGTCTTCGTGCTGGGTCTGGGTCTGACCCCACCGACCCTG GCTCAGGATAACTCCAGGTACACACACTTCCTGACCCAGCACTATGATGCCAAACCACAGGGCCGGGAT GACAGATACTGTGAAAGCATCATGAGGAGACGGGGCCTGACCTCACCCTGCAAAGACATCAACACATTT ATTCATGGCAACAAGCGCAGCATCAAGGCCATCTGTGAAAACAAGAATGGAAACCCTCACAGAGAAAAC CTAAGAATAAGCAAGTCTTCTTTCCAGGTCACCACTTGCAAGCTACATGGAGGTTCCCCCTGGCCTCCA TGCCAGTACCGAGCCACAGCGGGGTTCAGAAACGTTGTTGTTGCTTGTGAAAATGGCTTACCTGTCCAC TTGGATCAGTCAATTTTCCGTCGTCCGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001097577 |
| Insert Size | 444 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001097577.2 |
| RefSeq Size | 742 bp |
| RefSeq ORF | 444 bp |
| Locus ID | 283 |
| UniProt ID | P03950 |
| Protein Families | Druggable Genome, Secreted Protein, Transmembrane |
| MW | 16.6 kDa |
| Gene Summary | The protein encoded by this gene is a member of the RNase A superfamily though it has relatively weak ribonucleolytic activity. This protein is a potent mediator of new blood vessel formation and thus, in addition to the name RNase5, is commonly called angiogenin. This protein induces angiogenesis after binding to actin on the surface of endothelial cells. This protein also accumulates at the nucleolus where it stimulates ribosomal transcription. Under stress conditions this protein translocates to the cytosol where it hydrolyzes cellular tRNAs and influences protein synthesis. A signal peptide is cleaved from the precursor protein to produce a mature protein which contains a nuclear localization signal, a cell binding motif, and a catalytic domain. This protein has been shown to be both neurotrophic and neuroprotective and the mature protein has antimicrobial activity against some bacteria and fungi, including S. pneumoniae and C. albicans. Due to its effect on rRNA production and angiogenesis this gene plays important roles in cell growth and tumor progression. Mutations in this gene are associated with progression of amyotrophic lateral sclerosis (ALS). This gene and the neighboring RNase4 gene share promoters and 5' exons though each gene then splices to a distinct 3' exon containing the complete coding region of each gene. Alternative splicing results in multiple transcript variants encoding the same protein. [provided by RefSeq, Jul 2020] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1 and 2 encode the same isoform. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC223486 | ANG (Myc-DDK-tagged)-Human angiogenin, ribonuclease, RNase A family, 5 (ANG), transcript variant 2 |
CNY 1,200.00 |
|
| RC223486L3 | Lenti ORF clone of Human angiogenin, ribonuclease, RNase A family, 5 (ANG), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC223486L4 | Lenti ORF clone of Human angiogenin, ribonuclease, RNase A family, 5 (ANG), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG223486 | ANG (tGFP-tagged) - Human angiogenin, ribonuclease, RNase A family, 5 (ANG), transcript variant 2 |
CNY 4,370.00 |
其它Angiogenin产品
