E2F5 (NM_001083589) Human Untagged Clone

CAT#: SC316042

E2F5 (untagged)-Human E2F transcription factor 5, p130-binding (E2F5), transcript variant 3



  "NM_001083589" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
E2F5 mouse monoclonal antibody,clone OTI1G9
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms E2F-5
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001083589, the custom clone sequence may differ by one or more nucleotides
ATGGACGATTCCATTAATAATAGATTTTCCTATGTAACTCATGAAGACATCTGTAATTGC
TTTAATGGTGATACACTTTTGGCCATTCAGGCACCTTCTGGTACACAACTGGAGGTACCC
ATTCCAGAAATGGGTCAGAATGGACAAAAGAAATACCAGATCAATCTAAAGAGTCATTCA
GGACCTATCCATGTGCTGCTTATAAATAAAGAGTCGAGTTCATCTAAGCCCGTGGTTTTT
CCTGTTCCCCCACCTGATGACCTCACACAGCCTTCCTCCCAGTCCTTGACTCCAGTGACT
CCACAGAAATCCAGCATGGCAACTCAAAATCTGCCTGAGCAACATGTCTCTGAAAGAAGC
CAGGCTCTGCAGCAGACATCAGCTACAGATATATCTTCAGCAGGATCTATTAGTGGAGAT
ATCATTGATGAGTTAATGTCTTCTGACGTGTTTCCTCTCTTAAGGCTTTCTCCTACCCCG
GCAGATGACTACAACTTTAATTTAGATGATAACGAAGGAGTTTGTGATCTGTTTGATGTC
CAGATACTAAATTAT
Restriction Sites Please inquire     
ACCN NM_001083589
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001083589.1, NP_001077058.1
RefSeq Size 1594 bp
RefSeq ORF 558 bp
Locus ID 1875
UniProt ID Q15329
Protein Families Druggable Genome, Transcription Factors
Protein Pathways Cell cycle, TGF-beta signaling pathway
Gene Summary The protein encoded by this gene is a member of the E2F family of transcription factors. The E2F family plays a crucial role in the control of cell cycle and action of tumor suppressor proteins and is also a target of the transforming proteins of small DNA tumor viruses. The E2F proteins contain several evolutionarily conserved domains that are present in most members of the family. These domains include a DNA binding domain, a dimerization domain which determines interaction with the differentiation regulated transcription factor proteins (DP), a transactivation domain enriched in acidic amino acids, and a tumor suppressor protein association domain which is embedded within the transactivation domain. This protein is differentially phosphorylated and is expressed in a wide variety of human tissues. It has higher identity to E2F4 than to other family members. Both this protein and E2F4 interact with tumor suppressor proteins p130 and p107, but not with pRB. Alternative splicing results in multiple variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) contains a distinct 5' UTR and lacks an in-frame portion of the 5' coding region, compared to variant 1. The resulting isoform (3) has a shorter N-terminus when compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...