United States
Germany
Japan
United Kingdom
China
NeuN (RBFOX3) (NM_001082575) Human Untagged Clone
CAT＃: SC315991
RBFOX3 (untagged)-Human RNA binding protein, fox-1 homolog (C. elegans) 3 (RBFOX3)
CNY 3,600.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | FOX-3; FOX3; HRNBP3; NEUN |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_001082575 edited
ATGGCCCAGCCCTACCCCCCCGCCCAGTACCCCCCTCCGCCACAGAACGGCATCCCTGCC GAGTATGCCCCGCCCCCACCGCACCCCACGCAGGACTACTCCGGCCAGACCCCGGTCCCC ACAGAGCATGGCATGACCCTGTACACACCAGCACAGACCCACCCCGAGCAGCCAGGCTCC GAGGCCAGCACACAGCCCATCGCCGGGACCCAGACAGTGCCGCAGACAGACGAGGCGGCA CAGACGGACAGCCAGCCGCTCCACCCCTCCGACCCTACAGAGAAGCAGCAGCCCAAGCGG CTACACGTCTCCAACATCCCCTTCCGGTTCAGGGACCCCGACTTGCGGCAAATGTTCGGG CAATTCGGAAAAATTTTAGACGTGGAGATCATTTTTAACGAGCGGGGCTCCAAGGGTTTT GGGTTTGTAACTTTTGAAACTAGCTCAGATGCTGACCGAGCCCGGGAGAAGCTGAATGGG ACGATCGTAGAGGGACGGAAAATTGAGGTCAATAATGCCACGGCCCGAGTGATGACCAAC AAGAAGACGGGGAACCCCTACACCAACGGCTGGAAGCTAAATCCAGTGGTCGGCGCAGTC TACGGGCCTGAATTCTATGCAGTGACGGGGTTCCCCTACCCCACCACCGGCACAGCCGTT GCCTACCGGGGCGCACATCTTCGGGGCCGGGGCCGGGCCGTGTATAATACATTTCGGGCT GCGCCACCCCCACCCCCCATCCCGACTTACGGAGCGGTCGTGTATCAGGATGGATTTTAT GGTGCTGAGATTTATGGAGGCTACGCAGCCTACAGATACGCTCAGCCCGCTGCAGCGGCG GCAGCCTACAGCGACAGTTACGGCAGAGTCTACGCAGCTGCCGACCCGTACCATCACACC ATCGGGCCCGCGGCGACCTACAGCATTGGAACCATGTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_001082575 |
| Insert Size | 1200 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001082575.1, NP_001076044.1 |
| RefSeq Size | 2696 bp |
| RefSeq ORF | 939 bp |
| Locus ID | 146713 |
| UniProt ID | A6NFN3 |
| Gene Summary | This gene encodes a member of the RNA-binding FOX protein family which is involved in the regulation of alternative splicing of pre-mRNA. The protein has an N-terminal proline-rich region, an RNA recognition motif (RRM) domain, and a C-terminal alanine-rich region. This gene produces the neuronal nuclei (NeuN) antigen that has been widely used as a marker for post-mitotic neurons. This gene has its highest expression in the central nervous system and plays a prominent role in neural tissue development and regulation of adult brain function. Mutations in this gene have been associated with numerous neurological disorders. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, May 2017] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC224826 | RBFOX3 (Myc-DDK-tagged)-Human RNA binding protein, fox-1 homolog (C. elegans) 3 (RBFOX3) |
CNY 3,600.00 |
|
| RC224826L1 | Lenti ORF clone of Human RNA binding protein, fox-1 homolog (C. elegans) 3 (RBFOX3), Myc-DDK-tagged |
CNY 6,000.00 |
|
| RC224826L2 | Lenti ORF clone of Human RNA binding protein, fox-1 homolog (C. elegans) 3 (RBFOX3), mGFP tagged |
CNY 5,890.00 |
|
| RC224826L3 | Lenti ORF clone of Human RNA binding protein, fox-1 homolog (C. elegans) 3 (RBFOX3), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC224826L4 | Lenti ORF clone of Human RNA binding protein, fox-1 homolog (C. elegans) 3 (RBFOX3), mGFP tagged |
CNY 5,890.00 |
|
| RG224826 | RBFOX3 (tGFP-tagged) - Human RNA binding protein, fox-1 homolog (C. elegans) 3 (RBFOX3) |
CNY 4,370.00 |
