United States
Germany
Japan
United Kingdom
China
GnRH (GNRH1) (NM_001083111) Human Untagged Clone
CAT＃: SC315978
GNRH1 (untagged)-Human gonadotropin-releasing hormone 1 (luteinizing-releasing hormone) (GNRH1), transcript variant 2
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | GNRH; GRH; LHRH; LNRH |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC315978 representing NM_001083111.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAAGCCAATTCAAAAACTCCTAGCTGGCCTTATTCTACTGACTTGGTGCGTGGAAGGCTGCTCCAGC CAGCACTGGTCCTATGGACTGCGCCCTGGAGGAAAGAGAGATGCCGAAAATTTGATTGATTCTTTCCAA GAGATAGTCAAAGAGGTTGGTCAACTGGCAGAAACCCAACGCTTCGAATGCACCACGCACCAGCCACGT TCTCCCCTCCGAGACCTGAAAGGAGCTCTGGAAAGTCTGATTGAAGAGGAAACTGGGCAGAAGAAGATT TAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001083111 |
| Insert Size | 279 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001083111.1 |
| RefSeq Size | 1297 bp |
| RefSeq ORF | 279 bp |
| Locus ID | 2796 |
| UniProt ID | P01148 |
| Protein Families | Druggable Genome, Secreted Protein |
| Protein Pathways | GnRH signaling pathway |
| MW | 10.4 kDa |
| Gene Summary | This gene encodes a preproprotein that is proteolytically processed to generate a peptide that is a member of the gonadotropin-releasing hormone (GnRH) family of peptides. Alternative splicing results in multiple transcript variants, at least one of which is secreted and then cleaved to generate gonadoliberin-1 and GnRH-associated peptide 1. Gonadoliberin-1 stimulates the release of luteinizing and follicle stimulating hormones, which are important for reproduction. Mutations in this gene are associated with hypogonadotropic hypogonadism. [provided by RefSeq, Nov 2015] Transcript Variant: This variant (2) differs at the 5' end compared to variant 1, which results in translation initiation from an in-frame downstream start codon, and an isoform (2) with a shorter N-terminus compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC219734 | GNRH1 (Myc-DDK-tagged)-Human gonadotropin-releasing hormone 1 (luteinizing-releasing hormone) (GNRH1), transcript variant 2 |
CNY 1,200.00 |
|
| RC219734L3 | Lenti ORF clone of Human gonadotropin-releasing hormone 1 (luteinizing-releasing hormone) (GNRH1), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC219734L4 | Lenti ORF clone of Human gonadotropin-releasing hormone 1 (luteinizing-releasing hormone) (GNRH1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG219734 | GNRH1 (tGFP-tagged) - Human gonadotropin-releasing hormone 1 (luteinizing-releasing hormone) (GNRH1), transcript variant 2 |
CNY 4,370.00 |
