JMJD6 (NM_001081461) Human Untagged Clone
CAT#: SC315948
JMJD6 (untagged)-Human jumonji domain containing 6 (JMJD6), transcript variant 1
CNY 3,656.00
CNY 6,650.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | PSR; PTDSR; PTDSR1 |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_001081461 edited
ATGAACCACAAGAGCAAGAAGCGCATCCGCGAGGCCAAGCGGAGTGCGCGGCCGGAGCTC AAGGACTCGCTGGATTGGACCCGGCACAACTACTACGAGAGCTTCTCGCTGAGCCCGGCG GCCGTGGCGGATAACGTGGAAAGGGCAGATGCTTTACAGCTGTCTGTGGAAGAATTTGTG GAGCGGTATGAAAGACCTTACAAGCCCGTGGTTTTGTTGAATGCGCAAGAGGGCTGGTCT GCGCAGGAGAAATGGACTCTGGAGCGCCTAAAAAGGAAATATCGGAACCAGAAGTTCAAG TGTGGTGAGGATAACGATGGCTACTCAGTGAAGATGAAGATGAAATACTACATCGAGTAC ATGGAGAGCACTCGAGATGATAGTCCCCTTTACATCTTTGACAGCAGCTATGGTGAACAC CCTAAAAGAAGGAAACTTTTGGAAGACTACAAGGTGCCAAAGTTTTTCACTGATGACCTT TTCCAGTATGCTGGGGAGAAGCGCAGGCCCCCTTACAGGTGGTTTGTGATGGGGCCACCA CGCTCCGGAACTGGGATTCACATCGACCCTCTGGGAACCAGTGCCTGGAATGCCTTAGTT CAGGGCCACAAGCGCTGGTGCCTGTTTCCTACCAGCACTCCCAGGGAACTCATCAAAGTG ACCCGAGACGAAGGAGGGAACCAGCAAGACGAAGCTATTACCTGGTTTAATGTTATTTAT CCCGGGACACAGCTTCCAACCTGGCCACCTGAATTCAAACCCCTGGAAATCTTACAAAAA CCAGGAGAGACTGTCTTTGTACCAGGAGGCTGGTGGCATGTTGTCCTCAATCTCGACACT ACTATCGCCATCACCCAAAATTTTGCCAGCAGCACCAACTTCCCTGTGGTATGGCACAAG ACGGTAAGAGGGAGACCAAAGTTATCAAGGAAATGGTATAGGATTTTGAAGCAAGAGCAC CCCGAGTTGGCAGTCCTCGCAGACTCGGTTGACCTTCAGGAGTCCACAGGGATAGCTTCC GACAGCTCCAGCGACTCTTCCAGCTCCTCCAGCTCCAGTTCGTCAGACTCCGACTCAGAG TGCGAGTCTGGATCCGAGGGCGATGGGACAGTGCACCGCAGGAAGAAGAGGAGGACGTGC AGCATGGTGGGAAACGGGGACACCACCTCCCAGGACGACTGTGTCAGCAAAGAGCGCAGC TCCTCCAGGATTAGGGACACTTGTGGAGGCCGGGCTCACCCCTGA |
Restriction Sites | Please inquire |
ACCN | NM_001081461 |
Insert Size | 1800 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The open reading frame of this clone has been fully sequenced and found one SNP within the protein associated with this reference, NM_001081461.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001081461.1, NP_001074930.1 |
RefSeq Size | 5445 bp |
RefSeq ORF | 1245 bp |
Locus ID | 23210 |
UniProt ID | Q6NYC1 |
Protein Families | Druggable Genome, ES Cell Differentiation/IPS |
Gene Summary | This gene encodes a nuclear protein with a JmjC domain. JmjC domain-containing proteins are predicted to function as protein hydroxylases or histone demethylases. This protein was first identified as a putative phosphatidylserine receptor involved in phagocytosis of apoptotic cells; however, subsequent studies have indicated that it does not directly function in the clearance of apoptotic cells, and questioned whether it is a true phosphatidylserine receptor. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218163 | JMJD6 (Myc-DDK-tagged)-Human jumonji domain containing 6 (JMJD6), transcript variant 1 |
CNY 3,656.00 |
|
RC218163L1 | Lenti ORF clone of Human jumonji domain containing 6 (JMJD6), transcript variant 1, Myc-DDK-tagged |
CNY 6,056.00 |
|
RC218163L2 | Lenti ORF clone of Human jumonji domain containing 6 (JMJD6), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC218163L3 | Lenti ORF clone of Human jumonji domain containing 6 (JMJD6), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC218163L4 | Lenti ORF clone of Human jumonji domain containing 6 (JMJD6), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG218163 | JMJD6 (tGFP-tagged) - Human jumonji domain containing 6 (JMJD6), transcript variant 1 |
CNY 5,256.00 |