Caspase 8 (CASP8) (NM_001080124) Human Untagged Clone

CAT#: SC315770

CASP8 (untagged)-Human caspase 8, apoptosis-related cysteine peptidase (CASP8), transcript variant F



  "NM_001080124" in other vectors (4)

CNY 7,410.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit polyclonal CASP8 Antibody (C-term)
    • 400 ul

CNY 6,314.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ALPS2B; CAP4; Casp-8; FLICE; MACH; MCH5
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001080124, the custom clone sequence may differ by one or more nucleotides
ATGGACTTCAGCAGAAATCTTTATGATATTGGGGAACAACTGGACAGTGAAGATCTGGCC
TCCCTCAAGTTCCTGAGCCTGGACTACATTCCGCAAAGGAAGCAAGAACCCATCAAGGAT
GCCTTGATGTTATTCCAGAGACTCCAGGAAAAGAGAATGTTGGAGGAAAGCAATCTGTCC
TTCCTGAAGGAGCTGCTCTTCCGAATTAATAGACTGGATTTGCTGATTACCTACCTAAAC
ACTAGAAAGGAGGAGATGGAAAGGGAACTTCAGACACCAGGCAGGGCTCAAATTTCTGCC
TACAGGGTCATGCTCTATCAGATTTCAGAAGAAGTGAGCAGATCAGAATTGAGGTCTTTT
AAGTTTCTTTTGCAAGAGGAAATCTCCAAATGCAAACTGGATGATGACATGAACCTGCTG
GATATTTTCATAGAGATGGAGAAGAGGGTCATCCTGGGAGAAGGAAAGTTGGACATCCTG
AAAAGAGTCTGTGCCCAAATCAACAAGAGCCTGCTGAAGATAATCAACGACTATGAAGAA
TTCAGCAAAGGGGAGGAGTTGTGTGGGGTAATGACAATCTCGGACTCTCCAAGAGAACAG
GATAGTGAATCACAGACTTTGGACAAAGTTTACCAAATGAAAAGCAAACCTCGGGGATAC
TGTCTGATCATCAACAATCACAATTTTGCAAAAGCACGGGAGAAAGTGCCCAAACTTCAC
AGCATTAGGGACAGGAATGGAACACACTTGGATGCAGGGGCTTTGACCACGACCTTTGAA
GAGCTTCATTTTGAGATCAAGCCCCACGATGACTGCACAGTAGAGCAAATCTATGAGATT
TTGAAAATCTACCAACTCATGGACCACAGTAACATGGACTGCTTCATCTGCTGTATCCTC
TCCCATGGAGACAAGGGCATCATCTATGGCACTGATGGACAGGAGGCCCCCATCTATGAG
CTGACATCTCAGTTCACTGGTTTGAAGTGCCCTTCCCTTGCTGGAAAACCCAAAGTGTTT
TTTATTCAGGCTTGTCAGGGGGATAACTACCAGAAAGGTATACCTGTTGAGACTGATTCA
GAGGAGCAACCCTATTTAGAAATGGATTTATCATCACCTCAAACGAGATATATCCCGGAT
GAGGCTGACTTTCTGCTGGGGATGGCCACTGTGAATAACTGTGTTTCCTACCGAAACCCT
GCAGAGGGAACCTGGTACATCCAGTCACTTTGCCAGAGCCTGAGAGAGCGATGTCCTCGA
GGCGATGATATTCTCACCATCCTGACTGAAGTGAACTATGAAGTAAGCAACAAGGATGAC
AAGAAAAACATGGGGAAACAGATGCCTCAGCCTACTTTCACACTAAGAAAAAAACTTGTC
TTCCCTTCTGAT
Restriction Sites Please inquire     
ACCN NM_001080124
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001080124.1, NP_001073593.1
RefSeq Size 2750 bp
RefSeq ORF 1395 bp
Locus ID 841
UniProt ID Q14790
Protein Families Druggable Genome, Protease
Protein Pathways Alzheimer's disease, Apoptosis, Huntington's disease, NOD-like receptor signaling pathway, p53 signaling pathway, Pathways in cancer, RIG-I-like receptor signaling pathway, Toll-like receptor signaling pathway, Viral myocarditis
Gene Summary This gene encodes a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes composed of a prodomain, a large protease subunit, and a small protease subunit. Activation of caspases requires proteolytic processing at conserved internal aspartic residues to generate a heterodimeric enzyme consisting of the large and small subunits. This protein is involved in the programmed cell death induced by Fas and various apoptotic stimuli. The N-terminal FADD-like death effector domain of this protein suggests that it may interact with Fas-interacting protein FADD. This protein was detected in the insoluble fraction of the affected brain region from Huntington disease patients but not in those from normal controls, which implicated the role in neurodegenerative diseases. Many alternatively spliced transcript variants encoding different isoforms have been described, although not all variants have had their full-length sequences determined. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (F) includes different segments in the 5' UTR and lacks an alternate in-frame segment in the coding region, compared to variant G. Variants C and F both encode isoform C, which is shorter than isoform G. Isoform C has also been labelled as Alpha-2 or MCH5-beta.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...