United States
Germany
Japan
United Kingdom
China
KIR2DL4 (NM_001080770) Human Untagged Clone
CAT＃: SC315741
KIR2DL4 (untagged)-Human killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 4 (KIR2DL4), transcript variant 3
CNY 5,510.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CD158D; G9P; KIR-2DL4; KIR-103AS; KIR103; KIR103AS |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC315741 representing NM_001080770.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCCATGTCACCCACGGTCATCATCCTGGCATGTCTTGGGTTCTTCTTGGACCAGAGTGTGTGGGCA CACGTGGGTGGTCAGGACAAGCCCTTCTGCTCTGCCTGGCCCAGCGCTGTGGTGCCTCAAGGAGGACAC GTGACTCTTCGGTGTCACTATCGTCGTGGGTTTAACATCTTCACGCTGTACAAGAAAGATGGGGTCCCT GTCCCTGAGCTCTACAACAGAATATTCTGGAACAGTTTCCTCATTAGCCCTGTGACCCCAGCACACGCA GGGACCTACAGATGTCGAGGTTTTCACCCGCACTCCCCCACTGAGTGGTCGGCACCCAGCAACCCCCTG GTGATCATGGTCACAGGTCTATATGAGAAACCTTCGCTTACAGCCCGGCCGGGCCCCACGGTTCGCGCA GGAGAGAACGTGACCTTGTCCTGCAGCTCCCAGAGCTCCTTTGACATCTACCATCTATCCAGGGAGGGG GAAGCCCATGAACTTAGGCTCCCTGCAGTGCCCAGCATCAATGGAACATTCCAGGCCGACTTCCCTCTG GGTCCTGCCACCCACGGAGAGACCTACAGATGCTTCGGCTCTTTCCATGGATCTCCCTACGAGTGGTCA GACCCGAGTGACCCACTGCCTGTTTCTGTCACAGGAAACCCTTCTAGTAGTTGGCCTTCACCCACTGAA CCAAGCTTCAAAACTGATGCTGCTGTAATGAACCAAGAGCCTGCGGGACACAGAACAGTGAACAGGGAG GACTCTGATGAACAAGACCCTCAGGAGGTGACATACGCACAGTTGGATCACTGCATTTTCACACAGAGA AAAATCACTGGCCCTTCTCAGAGGAGCAAGAGACCCTCAACAGATACCAGCGTGTGTATAGAACTTCCA AATGCTGAGCCCAGAGCGTTGTCTCCTGCCCATGAGCACCACAGTCAGGCCTTGATGGGATCTTCTAGG GAGACAACAGCCCTGTCTCAAACCCAGCTTGCCAGCTCTAATGTACCAGCAGCTGGAATCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001080770 |
| Insert Size | 1029 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001080770.1 |
| RefSeq Size | 1505 bp |
| RefSeq ORF | 1029 bp |
| Locus ID | 3805 |
| Protein Families | Transmembrane |
| Protein Pathways | Antigen processing and presentation, Natural killer cell mediated cytotoxicity |
| MW | 37.4 kDa |
| Gene Summary | Killer cell immunoglobulin-like receptors (KIRs) are transmembrane glycoproteins expressed by natural killer cells and subsets of T cells. The KIR genes are polymorphic and highly homologous and they are found in a cluster on chromosome 19q13.4 within the 1 Mb leukocyte receptor complex (LRC). The gene content of the KIR gene cluster varies among haplotypes, although several "framework" genes are found in all haplotypes (KIR3DL3, KIR3DP1, KIR3DL4, KIR3DL2). The KIR proteins are classified by the number of extracellular immunoglobulin domains (2D or 3D) and by whether they have a long (L) or short (S) cytoplasmic domain. KIR proteins with the long cytoplasmic domain transduce inhibitory signals upon ligand binding via an immune tyrosine-based inhibitory motif (ITIM), while KIR proteins with the short cytoplasmic domain lack the ITIM motif and instead associate with the TYRO protein tyrosine kinase binding protein to transduce activating signals. The ligands for several KIR proteins are subsets of HLA class I molecules; thus, KIR proteins are thought to play an important role in regulation of the immune response. This gene is one of the "framework" loci that is present on all haplotypes. Alternate alleles of this gene are represented on multiple alternate reference loci (ALT_REF_LOCs). Alternative splicing results in multiple transcript variants, some of which may not be annotated on the primary reference assembly. [provided by RefSeq, Jul 2016] Transcript Variant: This variant (3) lacks an internal exon in the coding region, compared to variant 1. It encodes isoform c, which is shorter than isoform a. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC214254 | KIR2DL4 (Myc-DDK-tagged)-Human killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 4 (KIR2DL4), transcript variant 3 |
CNY 3,656.00 |
|
| RC214254L3 | Lenti ORF clone of Human killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 4 (KIR2DL4), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC214254L4 | Lenti ORF clone of Human killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 4 (KIR2DL4), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
| RG214254 | KIR2DL4 (tGFP-tagged) - Human killer cell immunoglobulin-like receptor, two domains, long cytoplasmic tail, 4 (KIR2DL4), transcript variant 3 |
CNY 4,370.00 |
其它KIR2DL4产品
