PACRG (NM_001080378) Human Untagged Clone

CAT#: SC315709

PACRG (untagged)-Human PARK2 co-regulated (PACRG), transcript variant 2



  "NM_001080378" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit polyclonal anti-PACRG antibody
    • 100 ug

CNY 8,025.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GLUP; HAK005771; PACRG2.1; PARK2CRG
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC315709 representing NM_001080378.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGTGGCAGAAAAAGAGACCCTGAGCTTAAACAAATGCCCAGACAAGATGCCGAAGAGGACCAAGCTG
CTGGCACAACAGCCGCTCCCGGTGCACCAGCCTCACTCTCTGGTTTCTGAGGGTTTCACAGTCAAAGCC
ATGATGAAAAACTCAGTCGTGAGAGGCCCTCCAGCTGCAGGGGCATTTAAAGAAAGACCAACCAAGCCC
ACAGCATTTCGAAAATTCTATGAGCGAGGTGACTTCCCAATTGCCCTTGAGCATGATTCGAAAGGAAAC
AAAATCGCCTGGAAGGTAGAAATTGAGAAGCTGGATTACCATCATTATCTGCCTCTGTTTTTTGATGGG
CTTTGTGAAATGACATTTCCCTATGAGTTTTTTGCTCGGCAAGGAATCCACGACATGCTGGAACACGGT
GGGAACAAGATCCTACCTGTCCTTCCACAGCTCATTATCCCGATAAAAAATGCCTTGAACCTCCGAAAC
CGACAGGTCATCTGTGTCACTCTCAAGGTCCTCCAGCATCTGGTTGTGTCAGCTGAGATGGTGGGCAAG
GCCTTGGTGCCTTATTACCGTCAAATCCTCCCTGTCCTGAACATCTTTAAGAATATGAATGTGAACTCC
GGAGACGGCATTGACTACAGCCAGCAGAAGAGGGAGAACATTGGGGACTTGATCCAGGAGACACTGGAG
GCCTTCGAGCGCTACGGAGGAGAAAATGCCTTTATCAACATTAAGTACGTGGTCCCAACCTACGAGTCT
TGCTTGCTAAACTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001080378
Insert Size 774 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001080378.1
RefSeq Size 1585 bp
RefSeq ORF 774 bp
Locus ID 135138
UniProt ID Q96M98
Protein Families Druggable Genome
MW 29.3 kDa
Gene Summary This gene encodes a protein that is conserved across metazoans. In vertebrates, this gene is linked in a head-to-head arrangement with the adjacent parkin gene, which is associated with autosomal recessive juvenile Parkinson's disease. These genes are co-regulated in various tissues and they share a bi-directional promoter. Both genes are associated with susceptibility to leprosy. The parkin co-regulated gene protein forms a large molecular complex with chaperones, including heat shock proteins 70 and 90, and chaperonin components. This protein is also a component of Lewy bodies in Parkinson's disease patients, and it suppresses unfolded Pael receptor-induced neuronal cell death. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) lacks an alternate in-frame exon, compared to variant 1, resulting in a shorter protein (isoform 2), compared to isoform 1. Both variants 2 and 3 encode the same isoform.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...