PACRG (NM_001080378) Human Untagged Clone
CAT#: SC315709
PACRG (untagged)-Human PARK2 co-regulated (PACRG), transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | GLUP; HAK005771; PACRG2.1; PARK2CRG |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC315709 representing NM_001080378.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGTGGCAGAAAAAGAGACCCTGAGCTTAAACAAATGCCCAGACAAGATGCCGAAGAGGACCAAGCTG CTGGCACAACAGCCGCTCCCGGTGCACCAGCCTCACTCTCTGGTTTCTGAGGGTTTCACAGTCAAAGCC ATGATGAAAAACTCAGTCGTGAGAGGCCCTCCAGCTGCAGGGGCATTTAAAGAAAGACCAACCAAGCCC ACAGCATTTCGAAAATTCTATGAGCGAGGTGACTTCCCAATTGCCCTTGAGCATGATTCGAAAGGAAAC AAAATCGCCTGGAAGGTAGAAATTGAGAAGCTGGATTACCATCATTATCTGCCTCTGTTTTTTGATGGG CTTTGTGAAATGACATTTCCCTATGAGTTTTTTGCTCGGCAAGGAATCCACGACATGCTGGAACACGGT GGGAACAAGATCCTACCTGTCCTTCCACAGCTCATTATCCCGATAAAAAATGCCTTGAACCTCCGAAAC CGACAGGTCATCTGTGTCACTCTCAAGGTCCTCCAGCATCTGGTTGTGTCAGCTGAGATGGTGGGCAAG GCCTTGGTGCCTTATTACCGTCAAATCCTCCCTGTCCTGAACATCTTTAAGAATATGAATGTGAACTCC GGAGACGGCATTGACTACAGCCAGCAGAAGAGGGAGAACATTGGGGACTTGATCCAGGAGACACTGGAG GCCTTCGAGCGCTACGGAGGAGAAAATGCCTTTATCAACATTAAGTACGTGGTCCCAACCTACGAGTCT TGCTTGCTAAACTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001080378 |
Insert Size | 774 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001080378.1 |
RefSeq Size | 1585 bp |
RefSeq ORF | 774 bp |
Locus ID | 135138 |
UniProt ID | Q96M98 |
Protein Families | Druggable Genome |
MW | 29.3 kDa |
Gene Summary | This gene encodes a protein that is conserved across metazoans. In vertebrates, this gene is linked in a head-to-head arrangement with the adjacent parkin gene, which is associated with autosomal recessive juvenile Parkinson's disease. These genes are co-regulated in various tissues and they share a bi-directional promoter. Both genes are associated with susceptibility to leprosy. The parkin co-regulated gene protein forms a large molecular complex with chaperones, including heat shock proteins 70 and 90, and chaperonin components. This protein is also a component of Lewy bodies in Parkinson's disease patients, and it suppresses unfolded Pael receptor-induced neuronal cell death. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) lacks an alternate in-frame exon, compared to variant 1, resulting in a shorter protein (isoform 2), compared to isoform 1. Both variants 2 and 3 encode the same isoform. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222240 | PACRG (Myc-DDK-tagged)-Human PARK2 co-regulated (PACRG), transcript variant 2 |
CNY 2,400.00 |
|
RC222240L3 | Lenti ORF clone of Human PARK2 co-regulated (PACRG), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC222240L4 | Lenti ORF clone of Human PARK2 co-regulated (PACRG), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG222240 | PACRG (tGFP-tagged) - Human PARK2 co-regulated (PACRG), transcript variant 2 |
CNY 4,000.00 |