UNC119B (NM_001080533) Human Untagged Clone

CAT#: SC315704

UNC119B (untagged)-Human unc-119 homolog B (C. elegans) (UNC119B)



  "NM_001080533" in other vectors (4)

CNY 3,990.00


货期*
2周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-UNC119B Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms POC7B
Vector pCMV6-XL6
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_001080533 edited
ATGAGCGGGTCTAACCCGAAGGCTGCGGCCGCGGCGTCGGCGGCTGGGCCCGGGGGGCTG
GTGGCTGGCAAGGAGGAGAAGAAGAAGGCGGGCGGCGGCGTCCTGAACCGCCTGAAGGCG
CGGCGGCAGGCGCCCCACCACGCGGCCGACGACGGCGTCGGGGCAGCGGTCACGGAGCAG
GAGCTGCTGGCGCTGGACACCATCCGGCCCGAGCACGTCCTGCGCCTCAGCCGGGTCACC
GAGAATTATTTATGTAAACCCGAAGACAACATCTACAGTATTGATTTCACCCGCTTCAAA
ATTCGAGATTTGGAGACAGGGACAGTACTTTTTGAGATTGCCAAACCTTGCGTTTCAGAC
CAGGAGGAGGATGAGGAGGAGGGAGGTGGAGACGTGGACATCAGCGCAGGACGTTTTGTC
CGCTATCAGTTCACACCGGCATTTCTCCGCCTCCGGACAGTCGGGGCTACGGTGGAGTTC
ACAGTGGGAGACAAACCTGTTTCAAACTTCCGGATGATCGAACGGCACTATTTCCGGGAA
CACTTGCTGAAAAACTTTGACTTTGATTTTGGCTTCTGCATCCCCAGCAGTAGGAACACT
TGTGAACATATCTATGAGTTTCCCCAGCTTTCGGAGGATGTCATTCGTCTAATGATTGAA
AATCCTTACGAGACCCGCTCTGACAGCTTCTACTTTGTTGACAACAAGCTGATAATGCAC
AACAAGGCTGATTATGCCTATAATGGAGGCCAGTAA
Restriction Sites NotI-NotI     
ACCN NM_001080533
Insert Size 4400 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001080533.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001080533.1, NP_001074002.1
RefSeq Size 4811 bp
RefSeq ORF 756 bp
Locus ID 84747
UniProt ID A6NIH7
Gene Summary Myristoyl-binding protein that acts as a cargo adapter: specifically binds the myristoyl moiety of a subset of N-terminally myristoylated proteins and is required for their localization. Binds myristoylated NPHP3 and plays a key role in localization of NPHP3 to the primary cilium membrane. Does not bind all myristoylated proteins. Probably plays a role in trafficking proteins in photoreceptor cells.[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...