LYPD1 (NM_001077427) Human Untagged Clone
CAT#: SC315466
LYPD1 (untagged)-Human LY6/PLAUR domain containing 1 (LYPD1), transcript variant 2
CNY 1,200.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | LYPDC1; PHTS |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_001077427 edited
ATGTGTCAGAAAGAAGTGATGGAGCAAAGTGCCGGGATCATGTACCGCAAGTCCTGTGCA TCATCAGCGGCCTGTCTCATCGCCTCTGCCGGGTACCAGTCCTTCTGCTCCCCAGGGAAA CTGAACTCAGTTTGCATCAGCTGCTGCAACACCCCTCTTTGTAACGGGCCAAGGCCCAAG AAAAGGGGAAGTTCTGCCTCGGCCCTCAGGCCAGGGCTCCGCACCACCATCCTGTTCCTC AAATTAGCCCTCTTCTCGGCACACTGCTGA |
Restriction Sites | NotI-NotI |
ACCN | NM_001077427 |
Insert Size | 1600 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to the protein associated with this reference, NM_001077427.2. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001077427.1, NP_001070895.1 |
RefSeq Size | 1814 bp |
RefSeq ORF | 270 bp |
Locus ID | 116372 |
UniProt ID | Q8N2G4 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | Believed to act as a modulator of nicotinic acetylcholine receptors (nAChRs) activity. In vitro increases receptor desensitization and decreases affinity for ACh of alpha-4:beta-2-containing nAChRs. May play a role in the intracellular trafficking of alpha-4:beta-2 and alpha-7-containing nAChRs and may inhibit their expression at the cell surface. May be involved in the control of anxiety.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) contains a different segment for its 5' UTR and 5' coding region, compared to variant 1. This results in translation initiation at a downstream AUG and a protein (isoform b) with a shorter N-terminus compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC220675 | LYPD1 (Myc-DDK-tagged)-Human LY6/PLAUR domain containing 1 (LYPD1), transcript variant 2 |
CNY 1,200.00 |
|
RC220675L1 | Lenti ORF clone of Human LY6/PLAUR domain containing 1 (LYPD1), transcript variant 2, Myc-DDK-tagged |
CNY 3,600.00 |
|
RC220675L2 | Lenti ORF clone of Human LY6/PLAUR domain containing 1 (LYPD1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RC220675L3 | Lenti ORF clone of Human LY6/PLAUR domain containing 1 (LYPD1), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC220675L4 | Lenti ORF clone of Human LY6/PLAUR domain containing 1 (LYPD1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG220675 | LYPD1 (tGFP-tagged) - Human LY6/PLAUR domain containing 1 (LYPD1), transcript variant 2 |
CNY 2,800.00 |