United States
Germany
Japan
United Kingdom
China
Oct-2 (POU2F2) (NM_002698) Human Untagged Clone
CAT＃: SC313594
POU2F2 (untagged)-Human POU class 2 homeobox 2 (POU2F2), transcript variant 2
CNY 5,488.00
| Cited in 2 publications. |
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | Oct-2; OCT2; OTF2 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_002698 edited
ATGGTTCACTCCAGCATGGGGGCTCCAGAAATAAGAATGTCTAAGCCCCTGGAGGCCGAG AAGCAAGGTCTGGACTCCCCATCAGAGCACACAGACACCGAAAGAAATGGACCAGACACT AATCATCAGAACCCCCAAAATAAGACCTCCCCATTCTCCGTGTCCCCAACTGGCCCCAGT ACAAAGATCAAGGCTGAAGACCCCAGTGGCGATTCAGCCCCAGCAGCACCCCTGCCCCCT CAGCCGGCCCAGCCTCATCTGCCCCAGGCCCAACTCATGTTGACGGGCAGCCAGCTAGCT GGGGACATACAGCAGCTCCTCCAGCTCCAGCAGCTGGTGCTTGTGCCAGGCCACCACCTC CAGCCACCTGCTCAGTTCCTGCTACCGCAGGCCCAGCAGAGCCAGCCAGGCCTGCTACCG ACACCAAATCTATTCCAGCTACCTCAGCAAACCCAGGGAGCTCTTCTGACCTCCCAGCCC CGGGCCGGGCTTCCCACACAGCCCCCCAAATGCTTGGAGCCACCATCCCACCCCGAGGAG CCCAGTGATCTGGAGGAGCTGGAGCAATTCGCCCGCACCTTCAAGCAACGCCGCATCAAG CTGGGCTTCACGCAGGGTGATGTGGGCCTGGCCATGGGCAAGCTCTACGGCAACGACTTC AGCCAGACGACCATTTCCCGCTTCGAGGCCCTCAACCTGAGCTTCAAGAACATGTGCAAA CTCAAGCCCCTCCTGGAGAAGTGGCTCAACGATGCAGAGACTATGTCTGTGGACTCAAGC CTGCCCAGCCCCAACCAGCTGAGCAGCCCCAGCCTGGGTTTCGACGGCCTGCCCGGCCGG AGACGCAAGAAGAGGACCAGCATCGAGACAAACGTCCGCTTCGCCTTAGAGAAGAGTTTT CTAGCGAACCAGAAGCCTACCTCAGAGGAGATCCTGCTGATCGCCGAGCAGCTGCACATG GAGAAGGAAGTGATCCGCGTCTGGTTCTGCAACCGGCGCCAGAAGGAGAAACGCATCAAC CCCTGCAGTGCGGCCCCCATGCTGCCCAGCCCAGGGAAGCCGGCCAGCTACAGCCCCCAT ATGGTCACACCCCAAGGGGGCGCGGGGACCTTACCGTTGTCCCAAGCTTCCAGCAGTCTG AGCACAACAGTTACTACCTTATCCTCAGCTGTGGGGACGCTCCACCCCAGCCGGACAGCT GGAGGGGGTGGGGGCGGGGGCGGGGCTGCGCCCCCCCTCAATTCCATCCCCTCTGTCACT CCCCCACCCCCGGCCACCACCAACAGCACAAACCCCAGCCCTCAAGGCAGCCACTCGGCT ATCGGCTTGTCAGGCCTGAACCCCAGCACGGGCCCTGGCCTCTGGTGGAACCCTGCCCCT TACCAGCCTTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_002698 |
| Insert Size | 2100 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_002698.1, NP_002689.1 |
| RefSeq Size | 2048 bp |
| RefSeq ORF | 1392 bp |
| Locus ID | 5452 |
| UniProt ID | P09086 |
| Domains | POU, homeobox |
| Protein Families | Transcription Factors |
| Gene Summary | The protein encoded by this gene is a homeobox-containing transcription factor of the POU domain family. The encoded protein binds the octamer sequence 5'-ATTTGCAT-3', a common transcription factor binding site in immunoglobulin gene promoters. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011] Transcript Variant: This variant (2) uses an alternate in-frame splice junction at the 5' end of an exon compared to variant 1. The resulting isoform (2) has the same N- and C-termini but is shorter compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Citations (2)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Identification of functional amino Acid residues involved in polyamine and agmatine transport by human organic cation transporter 2
,Higashi, K;Imamura, M;Fudo, S;Uemura, T;Saiki, R;Hoshino, T;Toida, T;Kashiwagi, K;Igarashi, K;,
PLoS ONE July 2014
,PubMed ID 25019617
[POU2F2]
|
|
Influence of Oct1/Oct2-Deficiency on Cisplatin-Induced Changes in Urinary N-Acetyl-ß-D-Glucosaminidase
,Ryan M. Franke, Ashley M. Kosloske, Cynthia S. Lancaster, Kelly K. Filipski, Chaoxin Hu, Oliver Zolk, Ron H. Mathijssen, and Alex Sparreboom,
Clin. Cancer Res., Aug 2010; 16: 4198 - 4206
[POU2F2]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC216813 | POU2F2 (Myc-DDK-tagged)-Human POU class 2 homeobox 2 (POU2F2), transcript variant 2 |
CNY 5,488.00 |
|
| RC216813L1 | Lenti ORF clone of Human POU class 2 homeobox 2 (POU2F2), transcript variant 2, Myc-DDK-tagged |
CNY 7,888.00 |
|
| RC216813L2 | Lenti ORF clone of Human POU class 2 homeobox 2 (POU2F2), transcript variant 2, mGFP tagged |
CNY 5,990.00 |
|
| RC216813L3 | Lenti ORF clone of Human POU class 2 homeobox 2 (POU2F2), transcript variant 2, Myc-DDK-tagged |
CNY 5,990.00 |
|
| RC216813L4 | Lenti ORF clone of Human POU class 2 homeobox 2 (POU2F2), transcript variant 2, mGFP tagged |
CNY 7,888.00 |
|
| RG216813 | POU2F2 (tGFP-tagged) - Human POU class 2 homeobox 2 (POU2F2), transcript variant 2 |
CNY 7,088.00 |
