FBXO9 (NM_033480) Human Untagged Clone
CAT#: SC313468
FBXO9 (untagged)-Human F-box protein 9 (FBXO9), transcript variant 2
CNY 7,030.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | dJ341E18.2; FBX9; NY-REN-57; VCIA1 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_033480, the custom clone sequence may differ by one or more nucleotides
ATGGCAGAAGCTGAGGAAGATTGTCATTCTGATACTGTCAGAGCAGATGATGATGAAGAA AATGAAAGTCCTGCTGAAACAGATCTGCAGGCACAACTCCAGATGTTCCGAGCTCAGTGG ATGTTTGAACTTGCTCCAGGTGTAAGCTCTAGCAATTTAGAAAATCGACCTTGCAGAGCA GCAAGAGGCTCTCTCCAGAAAACATCGGCAGATACCAAAGGAAAACAAGAACAGGCAAAA GAAGAAAAGGCTCGAGAACTCTTCCTAAAAGCAGTAGAAGAAGAACAAAATGGAGCTCTC TATGAAGCCATCAAGTTTTATCGTAGGGCTATGCAACTTGTACCTGATATAGAGTTCAAG ATTACTTATACCCGGTCTCCAGATGGTGATGGCGTTGGAAACAGCTACATTGAAGATAAT GATGATGACAGCAAAATGGCAGATCTCTTGTCCTACTTCCAGCAGCAACTCACATTTCAG GAGTCTGTGCTTAAACTGTGTCAGCCTGAGCTTGAGAGCAGTCAGATTCACATATCAGTG CTGCCAATGGAGGTCCTGATGTACATCTTCCGATGGGTGGTGTCTAGTGACTTGGACCTC AGATCATTGGAGCAGTTGTCGCTGGTGTGCAGAGGATTCTACATCTGTGCCAGAGACCCT GAAATATGGCGTCTGGCCTGCTTGAAAGTTTGGGGCAGAAGCTGTATTAAACTTGTTCCG TACACGTCCTGGAGAGAGATGTTTTTAGAACGGCCTCGTGTTCGGTTTGATGGCGTGTAT ATCAGTAAAACCACATATATTCGTCAAGGGGAACAGTCTCTTGATGGTTTCTATAGAGCC TGGCACCAAGTGGAATATTACAGGTACATAAGATTCTTTCCTGATGGCCATGTGATGATG TTGACAACCCCTGAAGAGCCTCAGTCCATTGTTCCACGTTTAAGAACTAGGAATACCAGG ACTGATGCAATTCTACTGGGTCACTATCGCTTGTCACAAGACACAGACAATCAGACCAAA GTATTTGCTGTAATAACTAAGAAAAAAGAAGAAAAACCACTTGACTATAAATACAGATAT TTTCGTCGTGTCCCTGTACAAGAAGCAGATCAGAGTTTTCATGTGGGGCTACAGCTATGT TCCAGTGGTCACCAGAGGTTCAACAAACTCATCTGGATACATCATTCTTGTCACATTACT TACAAATCAACTGGTGAGACTGCAGTCAGTGCTTTTGAGATTGACAAGATGTACACCCCC TTGTTCTTCGCCAGAGTAAGGAGCTACACAGCTTTCTCAGAAAGGCCTCTG |
Restriction Sites | Please inquire |
ACCN | NM_033480 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_033480.1, NP_258441.1 |
RefSeq Size | 3454 bp |
RefSeq ORF | 1314 bp |
Locus ID | 26268 |
UniProt ID | Q9UK97 |
Domains | F-box |
Protein Families | Druggable Genome |
Gene Summary | This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbxs class. Alternative splicing of this gene generates at least 3 transcript variants diverging at the 5' terminus. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) contains a different segment for the 5' UTR and 5' coding region, compared to variant 1. It uses a different translation start codon and the encoded protein (isoform 2) has a shorter and distinct N-terminus when it is compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212734 | FBXO9 (Myc-DDK-tagged)-Human F-box protein 9 (FBXO9), transcript variant 2 |
CNY 3,656.00 |
|
RC212734L3 | Lenti-ORF clone of FBXO9 (Myc-DDK-tagged)-Human F-box protein 9 (FBXO9), transcript variant 2 |
CNY 5,890.00 |
|
RC212734L4 | Lenti-ORF clone of FBXO9 (mGFP-tagged)-Human F-box protein 9 (FBXO9), transcript variant 2 |
CNY 5,890.00 |
|
RG212734 | FBXO9 (tGFP-tagged) - Human F-box protein 9 (FBXO9), transcript variant 2 |
CNY 4,370.00 |