DNAAF4 (NM_130810) Human Untagged Clone
CAT#: SC313387
DYX1C1 (untagged)-Human dyslexia susceptibility 1 candidate 1 (DYX1C1), transcript variant 1
CNY 3,656.00
CNY 6,750.00
Cited in 1 publication. |
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CILD25; DYX1; DYX1C1; DYXC1; EKN1; RD |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_130810 edited
CCAGCCGCGCTATCCGCTCCCGTTGCTACCGGAATGCCTCTTCAGGTTAGCGATTACAGC TGGCAGCAGACGAAGACTGCGGTCTTTCTGTCTCTGCCCCTCAAAGGCGTGTGCGTCAGA GACACGGACGTGTTCTGCACGGAAAACTATCTGAAGGTCAACTTTCCTCCATTTTTATTT GAGGCATTTCTTTATGCTCCCATAGACGATGAGAGCAGCAAAGCAAAGATTGGGAATGAC ACCATTGTCTTCACCTTGTATAAAAAAGAAGCGGCCATGTGGGAGACCCTTTCTGTGACG GGTGTGACAAAGAGATGATGCAAAGAATTAGAGAAAAATCTATTTTACAAGCACAAGAGA GAGCAAAAGAAGCTACAGAAGCAAAAGCTGCAGCAAAGCGGGAAGATCAAAAATACGCAC TAAGTGTCATGATGAAGATTGAAGAAGAAGAGAGGAAAAAAATAGAAGATATGAAAGAAA ATGAACGGATAAAAGCCACTAAAGCATTGGAAGCCTGGAAAGAATATCAAAGAAAAGCTG AGGAGCAAAAAAAAATTCAGAGAGAAGAGAAATTATGTCAAAAAGAAAAGCAAATTAAAG AAGGAAGAAAAAAAATAAAATATAAGAGTCTTACTAGAAATTTGGCATCTAGAAATCTTG CTCCAAAAGGGAGAAATTCAGAAAATATATTTACTGAGAAGTTAAAGGAAGACAGTATTC CTGCTCCTCGCTCTGTTGGCAGTATTAAAATCAACTTTACCCCTCGAGTATTCCCAACAG CTCTTCGTGAATCACAAGTAGCAGAAGAGGAGGAGTGGCTACACAAACAAGCTGAGGCAC GAAGAGCAATGAATACTGACATAGCTGAACTTTGCGATTTAAAAGAAGAAGAAAAGAACC CAGAATGGTTGAAGGATAAAGGAAACAAATTGTTTGCAACGGAAAACTATTTGGCAGCTA TCAATGCATATAATTTAGCCATAAGACTAAATAATAAGATGCCACTATTGTATTTGAACC GGGCTGCTTGCCACCTAAAACTAAAAAACTTACACAAGGCTATTGAAGATTCTTCTAAGG CACTGGAATTATTGATGCCACCTGTTACAGACAATGCTAATGCAAGAATGAAGGCACATG TACGACGTGGAACAGCATTCTGTCAACTAGAATTGTATGTAGAAGGCCTACAGGATTATG AAGCGGCACTTAAGATTGATCCATCCAACAAAATTGTACAAATTGATGCTGAGAAGATTC GGAATGTAATTCAAGGAACAGAACTAAAATCTTAA |
Restriction Sites | Please inquire |
ACCN | NM_130810 |
Insert Size | 1300 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_130810.1, NP_570722.1 |
RefSeq Size | 1993 bp |
RefSeq ORF | 1263 bp |
Locus ID | 161582 |
UniProt ID | Q8WXU2 |
Domains | TPR |
Gene Summary | This gene encodes a tetratricopeptide repeat domain-containing protein. The encoded protein interacts with estrogen receptors and the heat shock proteins, Hsp70 and Hsp90. An homologous protein in rat has been shown to function in neuronal migration in the developing neocortex. A chromosomal translocation involving this gene is associated with a susceptibility to developmental dyslexia. Mutations in this gene are associated with deficits in reading and spelling. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the downstream cell cycle progression 1 (CCPG1) gene. [provided by RefSeq, Mar 2011] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (a). |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
DYX1C1 is required for axonemal dynein assembly and ciliary motility
,Aarti Tarkar, Niki T Loges, Christopher E Slagle, Richard Francis, Gerard W Dougherty, + et al.,
Nature Genetics doi:10.1038/ng.2707
,PubMed ID 23872636
[DNAAF4]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC214186 | DYX1C1 (Myc-DDK-tagged)-Human dyslexia susceptibility 1 candidate 1 (DYX1C1), transcript variant 1 |
CNY 3,656.00 |
|
RC214186L3 | Lenti-ORF clone of DYX1C1 (Myc-DDK-tagged)-Human dyslexia susceptibility 1 candidate 1 (DYX1C1), transcript variant 1 |
CNY 5,890.00 |
|
RC214186L4 | Lenti-ORF clone of DYX1C1 (mGFP-tagged)-Human dyslexia susceptibility 1 candidate 1 (DYX1C1), transcript variant 1 |
CNY 6,056.00 |
|
RG214186 | DYX1C1 (tGFP-tagged) - Human dyslexia susceptibility 1 candidate 1 (DYX1C1), transcript variant 1 |
CNY 4,370.00 |