BTBD7 (NM_018167) Human Untagged Clone
CAT#: SC313341
BTBD7 (untagged)-Human BTB (POZ) domain containing 7 (BTBD7), transcript variant 2
CNY 6,650.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | FUP1 |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_018167, the custom clone sequence may differ by one or more nucleotides
ATGGGTGCTAATGCATCTAATTATCCTCATTCATGTTCCCCGAGGGTAGGGGGAAATTCACAGGCCCAAC AGACTTTTATAGGGACCTCATCCTATTCTCAGCAAGGCTATGGTTGCGAATCAAAGTTGTATAGCCTTGA CCATGGCCATGAGAAACCACAAGACAAAAAAAAGAGAACCTCTGGTCTTGCCACCCTCAAAAAGAAGTTT ATTAAGCGTCGGAAATCTAATAGGTCTGCCGATCATGCCAAGCAGATGCGAGAACTCCTCTCTGGGTGGG ATGTTAGAGATGTCAATGCATTAGTGGAGGAATATGAGGGAACATCAGCATTAAAGGAGCTTTCTCTACA AGCCAGTTTGGCTAGACCAGAAGCCCGGACATTGCAGAAAGATATGGCTGATCTTTATGAGTACAAGTAT TGTACTGATGTAGACTTAATATTTCAAGAAACTTGTTTTCCTGTTCATCGTGCCATTTTGGCAGCAAGGT GTCCATTTTTTAAAACACTGCTTTCTTCCTCACCAGAGTATGGGGCAGAGATAATAATGGACATCAATAC AGCTGGTATTGATATGCCCATGTTTTCTGCTTTGTTACACTACCTTTATACAGGAGAGTTTGGAATGGAG GACTCAAGGTTTCAAAATGTCGATATCCTTGTTCAGCTTAGTGAAGAATTTGGAACACCAAATTCCCTTG ATGTAGATATGCGTGGACTCTTTGATTACATGTGTTATTATGATGTCGTCCTTAGTTTTTCTTCAGACTC TGAACTGGTTGAAGCTTTTGGTGGAAATCAGAACTGTTTAGATGAAGAGCTCAAAGCCCACAAGGCTGTT ATTTCTGCACGGTCCCCATTTTTTCGAAATTTATTACAAAGGAGGATACGAACTGGTGAAGAAATCACAG ACCGAACTTTGAGGACTCCCACAAGAATTATATTAGATGAGTCCATTATACCAAAAAAATATGCAACAGT GATATTACACTGTATGTATACCGACGTGGTGGACCTCTCTGTTTTGCACTGTAGCCCCTCTGTGGGGAGT CTCAGTGAAGTTCAGGCTCTCGTCGCAGGGAAGCCAAACATGACCAGGGCAGAAGAAGCCATGGAACTTT ACCACATAGCACTGTTCTTGGAATTTAACATGCTTGCACAAGAGGAGACTACAGTCATCAGGCCTGCCTG TGCAGCAGAGCTTTCAAACAGCTGCTTACTGCCTCAATCTTAA |
Restriction Sites | Please inquire |
ACCN | NM_018167 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_018167.3, NP_060637.1 |
RefSeq Size | 2568 bp |
RefSeq ORF | 1233 bp |
Locus ID | 55727 |
UniProt ID | Q9P203 |
Domains | BTB |
Gene Summary | Acts as a mediator of epithelial dynamics and organ branching by promoting cleft progression. Induced following accumulation of fibronectin in forming clefts, leading to local expression of the cell-scattering SNAIL2 and suppression of E-cadherin levels, thereby altering cell morphology and reducing cell-cell adhesion. This stimulates cell separation at the base of forming clefts by local, dynamic intercellular gap formation and promotes cleft progression (By similarity).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) lacks multiple 3' coding exons and contains an alternate 3' terminal exon, resulting in a different 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (2) has a distinct C-terminus and is shorter than isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC218190 | BTBD7 (Myc-DDK-tagged)-Human BTB (POZ) domain containing 7 (BTBD7), transcript variant 2 |
CNY 3,656.00 |
|
RC218190L3 | Lenti ORF clone of Human BTB (POZ) domain containing 7 (BTBD7), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC218190L4 | Lenti ORF clone of Human BTB (POZ) domain containing 7 (BTBD7), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG218190 | BTBD7 (tGFP-tagged) - Human BTB (POZ) domain containing 7 (BTBD7), transcript variant 2 |
CNY 4,370.00 |