BTBD7 (NM_018167) Human Untagged Clone

CAT#: SC313341

BTBD7 (untagged)-Human BTB (POZ) domain containing 7 (BTBD7), transcript variant 2



  "NM_018167" in other vectors (4)

CNY 6,650.00


货期*
5周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-BTBD7 Antibody
    • 50 ug

CNY 4,628.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms FUP1
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>NCBI ORF sequence for NM_018167, the custom clone sequence may differ by one or more nucleotides


ATGGGTGCTAATGCATCTAATTATCCTCATTCATGTTCCCCGAGGGTAGGGGGAAATTCACAGGCCCAAC
AGACTTTTATAGGGACCTCATCCTATTCTCAGCAAGGCTATGGTTGCGAATCAAAGTTGTATAGCCTTGA
CCATGGCCATGAGAAACCACAAGACAAAAAAAAGAGAACCTCTGGTCTTGCCACCCTCAAAAAGAAGTTT
ATTAAGCGTCGGAAATCTAATAGGTCTGCCGATCATGCCAAGCAGATGCGAGAACTCCTCTCTGGGTGGG
ATGTTAGAGATGTCAATGCATTAGTGGAGGAATATGAGGGAACATCAGCATTAAAGGAGCTTTCTCTACA
AGCCAGTTTGGCTAGACCAGAAGCCCGGACATTGCAGAAAGATATGGCTGATCTTTATGAGTACAAGTAT
TGTACTGATGTAGACTTAATATTTCAAGAAACTTGTTTTCCTGTTCATCGTGCCATTTTGGCAGCAAGGT
GTCCATTTTTTAAAACACTGCTTTCTTCCTCACCAGAGTATGGGGCAGAGATAATAATGGACATCAATAC
AGCTGGTATTGATATGCCCATGTTTTCTGCTTTGTTACACTACCTTTATACAGGAGAGTTTGGAATGGAG
GACTCAAGGTTTCAAAATGTCGATATCCTTGTTCAGCTTAGTGAAGAATTTGGAACACCAAATTCCCTTG
ATGTAGATATGCGTGGACTCTTTGATTACATGTGTTATTATGATGTCGTCCTTAGTTTTTCTTCAGACTC
TGAACTGGTTGAAGCTTTTGGTGGAAATCAGAACTGTTTAGATGAAGAGCTCAAAGCCCACAAGGCTGTT
ATTTCTGCACGGTCCCCATTTTTTCGAAATTTATTACAAAGGAGGATACGAACTGGTGAAGAAATCACAG
ACCGAACTTTGAGGACTCCCACAAGAATTATATTAGATGAGTCCATTATACCAAAAAAATATGCAACAGT
GATATTACACTGTATGTATACCGACGTGGTGGACCTCTCTGTTTTGCACTGTAGCCCCTCTGTGGGGAGT
CTCAGTGAAGTTCAGGCTCTCGTCGCAGGGAAGCCAAACATGACCAGGGCAGAAGAAGCCATGGAACTTT
ACCACATAGCACTGTTCTTGGAATTTAACATGCTTGCACAAGAGGAGACTACAGTCATCAGGCCTGCCTG
TGCAGCAGAGCTTTCAAACAGCTGCTTACTGCCTCAATCTTAA


Restriction Sites Please inquire     
ACCN NM_018167
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_018167.3, NP_060637.1
RefSeq Size 2568 bp
RefSeq ORF 1233 bp
Locus ID 55727
UniProt ID Q9P203
Domains BTB
Gene Summary Acts as a mediator of epithelial dynamics and organ branching by promoting cleft progression. Induced following accumulation of fibronectin in forming clefts, leading to local expression of the cell-scattering SNAIL2 and suppression of E-cadherin levels, thereby altering cell morphology and reducing cell-cell adhesion. This stimulates cell separation at the base of forming clefts by local, dynamic intercellular gap formation and promotes cleft progression (By similarity).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) lacks multiple 3' coding exons and contains an alternate 3' terminal exon, resulting in a different 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (2) has a distinct C-terminus and is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...