United States
Germany
Japan
United Kingdom
China
Rad51L1 (RAD51B) (NM_133510) Human Untagged Clone
CAT＃: SC313077
RAD51B (untagged)-Human RAD51-like 1 (S. cerevisiae) (RAD51L1), transcript variant 2
CNY 5,700.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | R51H2; RAD51L1; REC2 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_133510, the custom clone sequence may differ by one or more nucleotides
ATGGGTAGCAAGAAACTAAAACGAGTGGGTTTATCACAAGAGCTGTGTGACCGTCTGAGT AGACATCAGATCCTTACCTGTCAGGACTTTTTATGTCTTTCCCCACTGGAGCTTATGAAG GTGACTGGTCTGAGTTATCGAGGTGTCCATGAACTTCTATGTATGGTCAGCAGGGCCTGT GCCCCAAAGATGCAAACGGCTTATGGGATAAAAGCACAAAGGTCTGCTGATTTCTCACCA GCATTCTTATCTACTACCCTTTCTGCTTTGGACGAAGCCCTGCATGGTGGTGTGGCTTGT GGATCCCTCACAGAGATTACAGGTCCACCAGGTTGTGGAAAAACTCAGTTTTGTATAATG ATGAGCATTTTGGCTACATTACCCACCAACATGGGAGGATTAGAAGGAGCTGTGGTGTAC ATTGACACAGAGTCTGCATTTAGTGCTGAAAGACTGGTTGAAATAGCAGAATCCCGTTTT CCCAGATATTTTAACACTGAAGAAAAGTTACTTTTGACAAGTAGTAAAGTTCATCTTTAT CGGGAACTCACCTGTGATGAAGTTCTACAAAGGATTGAATCTTTGGAAGAAGAAATTATC TCAAAAGGAATTAAACTTGTGATTCTTGACTCTGTTGCTTCTGTGGTCAGAAAGGAGTTT GATGCACAACTTCAAGGCAATCTCAAAGAAAGAAACAAGTTCTTGGCAAGAGAGGCATCC TCCTTGAAGTATTTGGCTGAGGAGTTTTCAATCCCAGTTATCTTGACGAATCAGATTACA ACCCATCTGAGTGGAGCCCTGGCTTCTCAGGCAGACCTGGTGTCTCCAGCTGATGATTTG TCCCTGTCTGAAGGCACTTCTGGATCCAGCTGTGTGATAGCCGCACTAGGAAATACCTGG AGTCACAGTGTGAATACCCGGCTGATCCTCCAGTACCTTGATTCAGAGAGAAGACAGATT CTTATTGCCAAGTCCCCTCTGGCTCCCTTCACCTCATTTGTCTACACCATCAAGGAGGAA GGCCTGGTTCTTCAAGGCCAAGAGAAGCCA |
| Restriction Sites | Please inquire |
| ACCN | NM_133510 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_133510.2, NP_598194.1 |
| RefSeq Size | 1566 bp |
| RefSeq ORF | 1053 bp |
| Locus ID | 5890 |
| UniProt ID | O15315 |
| Protein Families | Druggable Genome |
| Protein Pathways | Homologous recombination |
| Gene Summary | The protein encoded by this gene is a member of the RAD51 protein family. RAD51 family members are evolutionarily conserved proteins essential for DNA repair by homologous recombination. This protein has been shown to form a stable heterodimer with the family member RAD51C, which further interacts with the other family members, such as RAD51, XRCC2, and XRCC3. Overexpression of this gene was found to cause cell cycle G1 delay and cell apoptosis, which suggested a role of this protein in sensing DNA damage. Rearrangements between this locus and high mobility group AT-hook 2 (HMGA2, GeneID 8091) have been observed in uterine leiomyomata. [provided by RefSeq, Mar 2016] Transcript Variant: This variant (2) has an alternate exon at the 3' end compared to the longest variant (3). The resulting isoform (2) has a distinct and shorter C-terminus, as compared to isoform 3. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC218537 | RAD51B (Myc-DDK-tagged)-Human RAD51-like 1 (S. cerevisiae) (RAD51L1), transcript variant 2 |
CNY 3,990.00 |
|
| RC218537L3 | Lenti-ORF clone of RAD51B (Myc-DDK-tagged)-Human RAD51-like 1 (S. cerevisiae) (RAD51L1), transcript variant 2 |
CNY 5,890.00 |
|
| RC218537L4 | Lenti-ORF clone of RAD51B (mGFP-tagged)-Human RAD51-like 1 (S. cerevisiae) (RAD51L1), transcript variant 2 |
CNY 5,890.00 |
|
| RG218537 | RAD51B (tGFP-tagged) - Human RAD51-like 1 (S. cerevisiae) (RAD51L1), transcript variant 2 |
CNY 4,370.00 |
其它Rad51L1产品
