OPCML (NM_002545) Human Untagged Clone
CAT#: SC313047
OPCML (untagged)-Human opioid binding protein/cell adhesion molecule-like (OPCML), transcript variant 1
CNY 4,024.00
CNY 7,220.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | IGLON1; OBCAM; OPCM |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC313047 representing NM_002545.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGGGGTCTGTGGGTACCTGTTCCTGCCCTGGAAGTGCCTCGTGGTCGTGTCTCTCAGGCTGCTGTTC CTTGTACCCACAGGAGTGCCCGTGCGCAGCGGAGATGCCACCTTCCCCAAAGCTATGGACAACGTGACG GTCCGGCAGGGGGAGAGCGCCACCCTCAGGTGTACCATAGATGACCGGGTAACCCGGGTGGCCTGGCTA AACCGCAGCACCATCCTCTACGCTGGGAATGACAAGTGGTCCATAGACCCTCGTGTGATCATCCTGGTC AATACACCAACCCAGTACAGCATCATGATCCAAAATGTGGATGTGTATGACGAAGGTCCGTACACCTGC TCTGTGCAGACAGACAATCATCCCAAAACGTCCCGGGTTCACCTAATAGTGCAAGTTCCTCCTCAGATC ATGAATATCTCCTCAGACATCACTGTGAATGAGGGAAGCAGTGTGACCCTGCTGTGTCTTGCTATTGGC AGACCAGAGCCAACTGTGACATGGAGACACCTGTCAGTCAAGGAAGGCCAGGGCTTTGTAAGTGAGGAT GAGTACCTGGAGATCTCTGACATCAAGCGAGACCAGTCCGGGGAGTACGAATGCAGCGCGTTGAACGAT GTCGCTGCGCCCGATGTGCGGAAAGTAAAAATCACTGTAAACTATCCTCCCTATATCTCAAAAGCCAAG AACACTGGTGTTTCAGTCGGTCAGAAGGGCATCCTGAGCTGTGAAGCCTCTGCAGTCCCCATGGCTGAA TTCCAGTGGTTCAAGGAAGAAACCAGGTTAGCCACTGGTCTGGATGGAATGAGGATTGAAAACAAAGGC CGCATGTCCACTCTGACTTTCTTCAATGTTTCAGAAAAGGATTATGGGAACTATACTTGTGTGGCCACG AACAAGCTTGGGAACACCAATGCCAGCATCACATTGTATGGGCCTGGAGCAGTCATTGATGGTGTAAAC TCGGCCTCCAGAGCACTGGCTTGTCTCTGGCTATCAGGGACCCTCTTAGCCCACTTCTTCATCAAGTTT TGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_002545 |
Insert Size | 1038 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_002545.4 |
RefSeq Size | 7111 bp |
RefSeq ORF | 1038 bp |
Locus ID | 4978 |
UniProt ID | Q14982 |
Domains | ig, IGc2, IG |
Protein Families | Druggable Genome, Transmembrane |
MW | 38 kDa |
Gene Summary | This gene encodes a member of the IgLON subfamily in the immunoglobulin protein superfamily of proteins. The encoded preprotein is proteolytically processed to generate the mature protein. This protein is localized in the plasma membrane and may have an accessory role in opioid receptor function. This gene has an ortholog in rat and bovine. The opioid binding-cell adhesion molecule encoded by the rat gene binds opioid alkaloids in the presence of acidic lipids, exhibits selectivity for mu ligands and acts as a GPI-anchored protein. Since the encoded protein is highly conserved in species during evolution, it may have a fundamental role in mammalian systems. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016] Transcript Variant: This variant (1) lacks an alternate in-frame exon in the 3' coding region compared to variant 3. The encoded isoform (a) is shorter than isoform c. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC213594 | OPCML (Myc-DDK-tagged)-Human opioid binding protein/cell adhesion molecule-like (OPCML), transcript variant 1 |
CNY 3,656.00 |
|
RC213594L3 | Lenti ORF clone of Human opioid binding protein/cell adhesion molecule-like (OPCML), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC213594L4 | Lenti ORF clone of Human opioid binding protein/cell adhesion molecule-like (OPCML), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG213594 | OPCML (tGFP-tagged) - Human opioid binding protein/cell adhesion molecule-like (OPCML), transcript variant 1 |
CNY 5,256.00 |