ST3GAL4 (NM_006278) Human Untagged Clone
CAT#: SC312986
ST3GAL4 (untagged)-Human ST3 beta-galactoside alpha-2,3-sialyltransferase 4 (ST3GAL4)
CNY 6,270.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CGS23; gal-NAc6S; NANTA3; SAT3; SIAT4; SIAT4C; ST-4; ST3GalA.2; ST3GalIV; STZ |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>NCBI ORF sequence for NM_006278, the custom clone sequence may differ by one or more nucleotides
ATGGTCAGCAAGTCCCGCTGGAAGCTCCTGGCCATGTTGGCTCTGGTCCTGGTCGTCATGGTGTGGTATT CCATCTCCCGGGAAGACAGTTTTTATTTTCCCATCCCAGAGAAGAAGGAGCCGTGCCTCCAGGGTGAGGC AGAGAGCAAGGCCTCTAAGCTCTTTGGCAACTACTCCCGGGATCAGCCCATCTTCCTGCGGCTTGAGGAT TATTTCTGGGTCAAGACGCCATCTGCTTACGAGCTGCCCTATGGGACCAAGGGGAGTGAGGATCTGCTCC TCCGGGTGCTAGCCATCACCAGCTCCTCCATCCCCAAGAACATCCAGAGCCTCAGGTGCCGCCGCTGTGT GGTCGTGGGGAACGGGCACCGGCTGCGGAACAGCTCACTGGGAGATGCCATCAACAAGTACGATGTGGTC ATCAGATTGAACAATGCCCCAGTGGCTGGCTATGAGGGTGACGTGGGCTCCAAGACCACCATGCGTCTCT TCTACCCTGAATCTGCCCACTTCGACCCCAAAGTAGAAAACAACCCAGACACACTCCTCGTCCTGGTAGC TTTCAAGGCAATGGACTTCCACTGGATTGAGACCATCCTGAGTGATAAGAAGCGGGTGCGAAAGGGTTTC TGGAAACAGCCTCCCCTCATCTGGGATGTCAATCCTAAACAGATTCGGATTCTCAACCCCTTCTTCATGG AGATTGCAGCTGACAAACTGCTGAGCCTGCCAATGCAACAGCCACGGAAGATTAAGCAGAAGCCCACCAC GGGCCTGTTGGCCATCACGCTGGCCCTCCACCTCTGTGACTTGGTGCACATTGCCGGCTTTGGCTACCCA GACGCCTACAACAAGAAGCAGACCATTCACTACTATGAGCAGATCACGCTCAAGTCCATGGCGGGGTCAG GCCATAATGTCTCCCAAGAGGCCCTGGCCATTAAGCGGATGCTGGAGATGGGAGCTATCAAGAACCTCAC GTCCTTCTGA |
Restriction Sites | Please inquire |
ACCN | NM_006278 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_006278.1, NP_006269.1 |
RefSeq Size | 1766 bp |
RefSeq ORF | 990 bp |
Locus ID | 6484 |
UniProt ID | Q11206 |
Domains | Glyco_transf_29 |
Protein Families | Secreted Protein, Transmembrane |
Protein Pathways | Glycosphingolipid biosynthesis - lacto and neolacto series, Metabolic pathways |
Gene Summary | This gene encodes a member of the glycosyltransferase 29 family, a group of enzymes involved in protein glycosylation. The encoded protein is targeted to Golgi membranes but may be proteolytically processed and secreted. The gene product may also be involved in the increased expression of sialyl Lewis X antigen seen in inflammatory responses. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011] Transcript Variant: This variant (1), as well as variant 9, encodes isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC216090 | ST3GAL4 (Myc-DDK-tagged)-Human ST3 beta-galactoside alpha-2,3-sialyltransferase 4 (ST3GAL4) |
CNY 3,600.00 |
|
RC216090L1 | Lenti-ORF clone of ST3GAL4 (Myc-DDK-tagged)-Human ST3 beta-galactoside alpha-2,3-sialyltransferase 4 (ST3GAL4) |
CNY 6,000.00 |
|
RC216090L2 | Lenti-ORF clone of ST3GAL4 (mGFP-tagged)-Human ST3 beta-galactoside alpha-2,3-sialyltransferase 4 (ST3GAL4) |
CNY 5,890.00 |
|
RC216090L3 | Lenti-ORF clone of ST3GAL4 (Myc-DDK-tagged)-Human ST3 beta-galactoside alpha-2,3-sialyltransferase 4 (ST3GAL4) |
CNY 6,000.00 |
|
RC216090L4 | Lenti-ORF clone of ST3GAL4 (mGFP-tagged)-Human ST3 beta-galactoside alpha-2,3-sialyltransferase 4 (ST3GAL4) |
CNY 5,890.00 |
|
RG216090 | ST3GAL4 (tGFP-tagged) - Human ST3 beta-galactoside alpha-2,3-sialyltransferase 4 (ST3GAL4) |
CNY 4,370.00 |
其它ST3GAL4产品