CHMP1A (NM_002768) Human Untagged Clone
CAT#: SC312936
CHMP1A (untagged)-Human chromatin modifying protein 1A (CHMP1A), transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CHMP1; PCH8; PCOLN3; PRSM1; VPS46-1; VPS46A |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC312936 representing NM_002768.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGACGATACCCTGTTCCAGTTGAAGTTCACGGCGAAGCAGCTGGAGAAGCTGGCCAAGAAGGCGGAG AAGGACTCCAAGGCGGAGCAGGCCAAAGTGAAGAAGGCCCTTCTGCAGAAAAATGTAGAGTGTGCCCGT GTGTATGCCGAGAACGCCATCCGCAAGAAGAACGAAGGTGTGAACTGGCTTCGGATGGCGTCCCGCGTA GACGCAGTGGCCTCCAAGGTGCAGACAGCTGTGACTATGAAGGGGGTGACCAAGAATATGGCCCAGGTG ACCAAAGCCCTGGACAAGGCCCTGAGCACCATGGACCTGCAGAAGGTCTCCTCAGTGATGGACAGGTTC GAGCAGCAGGTGCAGAACCTGGACGTCCATACATCGGTGATGGAGGACTCCATGAGCTCGGCCACCACC CTGACCACGCCGCAGGAGCAGGTGGACAGCCTCATCATGCAGATCGCCGAGGAGAATGGCCTGGAGGTG CTGGACCAGCTCAGCCAGCTGCCCGAGGGCGCCTCTGCCGTGGGCGAGAGCTCTGTGCGCAGCCAGGAG GACCAGCTGTCACGGAGGTTGGCCGCCTTGAGGAACTAG ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_002768 |
Insert Size | 591 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_002768.4 |
RefSeq Size | 2428 bp |
RefSeq ORF | 591 bp |
Locus ID | 5119 |
UniProt ID | Q9HD42 |
Protein Families | Druggable Genome, Transcription Factors |
MW | 21.7 kDa |
Gene Summary | This gene encodes a member of the CHMP/Chmp family of proteins which are involved in multivesicular body sorting of proteins to the interiors of lysosomes. The initial prediction of the protein sequence encoded by this gene suggested that the encoded protein was a metallopeptidase. The nomenclature has been updated recently to reflect the correct biological function of this encoded protein. Several transcripts encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012] Transcript Variant: This variant (2) encodes the functionally supported isoform (2). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC214991 | CHMP1A (Myc-DDK-tagged)-Human chromatin modifying protein 1A (CHMP1A), transcript variant 2 |
CNY 2,400.00 |
|
RC214991L3 | Lenti ORF clone of Human chromatin modifying protein 1A (CHMP1A), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC214991L4 | Lenti ORF clone of Human chromatin modifying protein 1A (CHMP1A), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG214991 | CHMP1A (tGFP-tagged) - Human chromatin modifying protein 1A (CHMP1A), transcript variant 2 |
CNY 4,370.00 |