Calpain 3 (CAPN3) (NM_173088) Human Untagged Clone

CAT#: SC312896

CAPN3 (untagged)-Human calpain 3, (p94) (CAPN3), transcript variant 4



  "NM_173088" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


CAPN3 Antibody - C-terminal region
    • 50 ug

CNY 4,628.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CANP3; CANPL3; LGMD2; LGMD2A; LGMDD4; LGMDR1; nCL-1; p94
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC312896 representing NM_173088.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCACGGGAACAAGCAGCACCTGCAGAAGGACTTCTTCCTGTACAACGCCTCCAAGGCCAGGAGCAAA
ACCTACATCAACATGCGGGAGGTGTCCCAGCGCTTCCGCCTGCCTCCCAGCGAGTACGTCATCGTGCCC
TCCACCTACGAGCCCCACCAGGAGGGGGAATTCATCCTCCGGGTCTTCTCTGAAAAGAGGAACCTCTCT
GAGGAAGTTGAAAATACCATCTCCGTGGATCGGCCAGTGAAAAAGAAAAAAACCAAGCCCATCATCTTC
GTTTCGGACAGAGCAAACAGCAACAAGGAGCTGGGTGTGGACCAGGAGTCAGAGGAGGGCAAAGGCAAA
ACAAGCCCTGATAAGCAAAAGCAGTCCCCACAGCCACAGCCTGGCAGCTCTGATCAGGAAAGTGAGGAA
CAGCAACAATTCCGGAACATTTTCAAGCAGATAGCAGGAGATGACATGGAGATCTGTGCAGATGAGCTC
AAGAAGGTCCTTAACACAGTCGTGAACAAACACAAGGACCTGAAGACACACGGGTTCACACTGGAGTCC
TGCCGTAGCATGATTGCGCTCATGGATACAGATGGCTCTGGAAAGCTCAACCTGCAGGAGTTCCACCAC
CTCTGGAACAAGATTAAGGCCTGGCAGAAAATTTTCAAACACTATGACACAGACCAGTCCGGCACCATC
AACAGCTACGAGATGCGAAATGCAGTCAACGACGCAGGATTCCACCTCAACAACCAGCTCTATGACATC
ATTACCATGCGGTACGCAGACAAACACATGAACATCGACTTTGACAGTTTCATCTGCTGCTTCGTTAGG
CTGGAGGGCATGTTCAGAGCTTTTCATGCATTTGACAAGGATGGAGATGGTATCATCAAGCTCAACGTT
CTGGAGTGGCTGCAGCTCACCATGTATGCCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_173088
Insert Size 930 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_173088.1
RefSeq Size 1661 bp
RefSeq ORF 930 bp
Locus ID 825
UniProt ID P20807
Protein Families Druggable Genome, Protease
MW 35.9 kDa
Gene Summary Calpain, a heterodimer consisting of a large and a small subunit, is a major intracellular protease, although its function has not been well established. This gene encodes a muscle-specific member of the calpain large subunit family that specifically binds to titin. Mutations in this gene are associated with limb-girdle muscular dystrophies type 2A. Alternate promoters and alternative splicing result in multiple transcript variants encoding different isoforms and some variants are ubiquitously expressed. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (4) differs in the 5' UTR and 5' coding region, and uses a downstream start codon, compared to variant 1. It encodes isoform d, which has a shorter N-terminus compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...