United States
Germany
Japan
United Kingdom
China
PPT2 (NM_138717) Human Untagged Clone
CAT＃: SC312893
PPT2 (untagged)-Human palmitoyl-protein thioesterase 2 (PPT2), transcript variant 2
CNY 3,600.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | C6orf8; G14; PPT-2 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>NCBI ORF sequence for NM_138717, the custom clone sequence may differ by one or more nucleotides
ATGAAGAGTTGCGGGAGCATGCTGGGGCTCTGCGGGCAGCGGCTCCCCGCGGCGTGGGTCCTGCTTCTGT TGCCTTTCCTGCCGCTGCTGCTGCTTGCAGCCCCCGCGCCCCACCGCGCGTCCTACAAGCCGGTCATCGT GGTGCATGGGCTCTTCGACAGCTCGTACAGCTTCCGCCACCTGCTGGAATACATCAATGAGACACACCCC GGGACTGTGGTGACAGTGCTCGATCTCTTCGATGGGAGAGAGAGCTTGCGACCCCTGTGGGAACAGGTGC AAGGGTTCCGAGAGGCTGTGGTCCCCATCATGGCAAAGGCCCCTCAAGGGGTGCATCTCATCTGCTACTC GCAGGGGGGCCTTGTGTGCCGGGCTCTGCTTTCTGTCATGGATGATCACAACGTGGATTCTTTCATCTCC CTCTCCTCTCCACAGATGGGACAGTATGGAGACACGGACTACTTGAAGTGGCTGTTCCCCACCTCCATGC GGTCTAACCTCTATCGGATCTGCTATAGCCCCTGGGGCCAGGAATTCTCCATCTGCAACTACTGGCATGA TCCCCACCACGATGACTTGTACCTCAATGCCAGCAGCTTCCTGGCCCTGATCAATGGGGAAAGAGACCAT CCCAATGCCACAGTATGGCGGAAGAACTTTCTGCGTGTGGGCCACCTGGTGCTGATTGGGGGCCCTGATG ATGGTGTTATTACTCCCTGGCAGTCCAGCTTCTTTGGTTTCTATGATGCAAATGAGACCGTCCTGGAGAT GGAGGAGCAACTGGTTTATCTGCGGGATTCTTTTGGGTTGAAGACTCTATTGGCCCGGGGGGCCATAGTG AGGTGTCCAATGGCCGGTATCTCCCACACAGCCTGGCACTCCAACCGTACCCTTTATGAGACCTGCATTG AACCTTGGCTCTCCTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_138717 |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_138717.1, NP_619731.1 |
| RefSeq Size | 1772 bp |
| RefSeq ORF | 927 bp |
| Locus ID | 9374 |
| UniProt ID | Q9UMR5 |
| Domains | Palm_thioest |
| Protein Families | Transmembrane |
| Protein Pathways | Fatty acid elongation in mitochondria, Lysosome, Metabolic pathways |
| Gene Summary | This gene encodes a member of the palmitoyl-protein thioesterase family. The encoded glycosylated lysosomal protein has palmitoyl-CoA hydrolase activity in vitro, but does not hydrolyze palmitate from cysteine residues in proteins. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the downstream EGFL8 (EGF-like-domain, multiple 8) gene. [provided by RefSeq, Feb 2011] Transcript Variant: This variant (2) differs in the 5' UTR and 5' coding region, and uses an alternate start codon, compared to variant 1. The resulting isoform (b) is longer at the N-terminus, compared to isoform a. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC214575 | PPT2 (Myc-DDK-tagged)-Human palmitoyl-protein thioesterase 2 (PPT2), transcript variant 2 |
CNY 3,600.00 |
|
| RC214575L3 | Lenti-ORF clone of PPT2 (Myc-DDK-tagged)-Human palmitoyl-protein thioesterase 2 (PPT2), transcript variant 2 |
CNY 5,890.00 |
|
| RC214575L4 | Lenti-ORF clone of PPT2 (mGFP-tagged)-Human palmitoyl-protein thioesterase 2 (PPT2), transcript variant 2 |
CNY 5,890.00 |
|
| RG214575 | PPT2 (tGFP-tagged) - Human palmitoyl-protein thioesterase 2 (PPT2), transcript variant 2 |
CNY 4,370.00 |
