ABI2 (X95677) Human Untagged Clone

CAT#: SC312856

(untagged)-H.sapiens mRNA for ArgBPIB protein



CNY 9,120.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


ABI2 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for X95677, the custom clone sequence may differ by one or more nucleotides
ATGAAGATGGGTGGGCTGCCGCGTACAACACCTCCAACTCAGAAGCCCCCTAGTCCCCCT
ATGTCAGGGAAAGGGACACTTGGCAGCAGTGGGAGTAGTGGAGGGAGCCACCCAAGTAGT
CGGAGCAGCAGTCGAGAGAACAGTGGAAGTGGTAGTGTGGGGGTTCCTATTGCTGTTCCT
ACTCCATCTCCTCCCAGTGTCTTTCCAGCCCCTGCGTGCTCTGCTGGCACTCCTCCCCTT
CCTGCTACTTCTGCATCTGCCCCTGCTCCTCTTGTTCCTGCTACTGTCCCTTCCTCCACT
GCCCCAGACGCTGCTGCTGGGGGTGCCCAGACCCTTGCTGATGGCTTCACTTCTCCAACT
CCCCCTGTTGTTTCTTCCACTCCCCCTACAGGTCATCCTGTACAGTTCTACAGCATGAAT
AGGCCTGCCTCTCGCCATACTCCCCCAACAATAGGGGGCTCGTTGCCCTATAGACGCCCT
CCTTCCATTACTTCACAAACAAGCCTTCAGAATCAGATGAATGGAGGACCTTTTTATAGC
CAGAATCCAGTTTCAGATACACCACCTCCACCGCCACCTGTGGAAGAACCAGTCTTTGAT
GAGTCTCCCCCACCTCCTCCTCCTCCAGAAGATTACGAAGAGGAGGAAGCTGCTGTGGTT
GAGTATAGTGATCCTTATGCTGAAGAGGACCCACCGTGGGCTCCACGTTCTTACTTGGAA
AAGGTTGTGGCAATTTATGACTATACAAAAGACAAGGAAGATGAGCTGTCCTTTCAGGAA
GGAGCCATTATTTATGTCATCAAGAAGAATGACGATGGTTGGTATGAGGGAGTTATGAAT
GGAGTGACTGGGCTTTTTCCTGGGAATTACGTTGAGTCTATCATGCATTATTCTGAG
Restriction Sites Please inquire     
ACCN X95677
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq X95677.1, CAA64980.1
RefSeq Size 2374 bp
RefSeq ORF 900 bp
Locus ID 10152
Domains SH3
Protein Pathways Regulation of actin cytoskeleton
Gene Summary Regulator of actin cytoskeleton dynamics underlying cell motility and adhesion. Functions as a component of the WAVE complex, which activates actin nucleating machinery Arp2/3 to drive lamellipodia formation (PubMed:21107423). Acts as regulator and substrate of nonreceptor tyrosine kinases ABL1 and ABL2 involved in processes linked to cell growth and differentiation. Positively regulates ABL1-mediated phosphorylation of ENAH, which is required for proper polymerization of nucleated actin filaments at the leading edge (PubMed:7590236, PubMed:8649853, PubMed:10498863). Contributes to the regulation of actin assembly at the tips of neuron projections. In particular, controls dendritic spine morphogenesis and may promote dendritic spine specification toward large mushroom-type spines known as repositories of memory in the brain (By similarity). In hippocampal neurons, may mediate actin-dependent BDNF-NTRK2 early endocytic trafficking that triggers dendrite outgrowth (By similarity). Participates in ocular lens morphogenesis, likely by regulating lamellipodia-driven adherens junction formation at the epithelial cell-secondary lens fiber interface (By similarity). Also required for nascent adherens junction assembly in epithelial cells (PubMed:15572692).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Customer Reviews 
Loading...