CLEC10A (NM_006344) Human Untagged Clone

CAT#: SC312828

CLEC10A (untagged)-Human C-type lectin domain family 10, member A (CLEC10A), transcript variant 2



  "NM_006344" in other vectors (6)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
CLEC10A mouse monoclonal antibody,clone OTI2B10
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CD301; CLECSF13; CLECSF14; HML; HML2; MGL
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC312828 representing NM_006344.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACAAGGACGTATGAAAACTTCCAGTACTTGGAGAATAAGGTGAAAGTCCAGGGGTTTAAAAATGGG
CCACTTCCTCTCCAGTCCCTCCTGCAGCGTCTCTGCTCTGGGCCCTGCCATCTCCTGCTGTCCCTGGGC
CTCGGCCTCCTGCTGCTGGTCATCATCTGTGTGGTTGGATTCCAAAATTCCAAATTTCAGAGGGACCTG
GTGACCCTGAGAACAGATTTTAGCAACTTCACCTCAAACACTGTGGCGGAGATCCAGGCACTGACTTCC
CAGGGCAGCAGCTTGGAAGAAACGATAGCATCTCTGAAAGCTGAGGTGGAGGGTTTCAAGCAGGAACGG
CAGGCAGTTCATTCTGAAATGCTCCTGCGAGTCCAGCAGCTGGTGCAAGACCTGAAGAAACTGACCTGC
CAGGTGGCTACTCTCAACAACAATGGTGAGGAAGCCTCCACTGAAGGGACCTGCTGCCCTGTCAACTGG
GTGGAGCACCAAGACAGCTGCTACTGGTTCTCTCACTCTGGGATGTCCTGGGCCGAGGCTGAGAAGTAC
TGCCAGCTGAAGAACGCCCACCTGGTGGTCATCAACTCCAGGGAGGAGCAGAATTTTGTCCAGAAATAT
CTAGGCTCCGCATACACCTGGATGGGCCTCAGTGACCCTGAAGGAGCCTGGAAGTGGGTGGATGGAACA
GACTATGCGACCGGCTTCCAGAACTGGAAGCCAGGCCAGCCAGACGACTGGCAGGGGCACGGGCTGGGT
GGAGGCGAGGACTGTGCTCACTTCCATCCAGACGGCAGGTGGAATGACGACGTCTGCCAGAGGCCCTAC
CACTGGGTCTGCGAGGCTGGCCTGGGTCAGACCAGCCAGGAGAGTCACTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_006344
Insert Size 879 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_006344.2
RefSeq Size 1716 bp
RefSeq ORF 879 bp
Locus ID 10462
UniProt ID Q8IUN9
Domains CLECT, lectin_N
Protein Families Transmembrane
MW 32.9 kDa
Gene Summary This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. The encoded type 2 transmembrane protein may function as a cell surface antigen. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) lacks an in-frame segment of the coding region, compared to variant 1. It encodes a shorter isoform (2), compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...