MARCH I (MARCH1) (NM_017923) Human Untagged Clone

CAT#: SC312747

41334 (untagged)-Human membrane-associated ring finger (C3HC4) 1 (MARCH1), transcript variant 2



  "NM_017923" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-MARCH1 Antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms MARCH-I; MARCH1; RNF171
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC312747 representing NM_017923.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGACCAGCAGCCACGTTTGTTGTAATTTTTTAAATATGTGGAAAAAAAGCAAGATATCAACCATGTAT
TACCTTAACCAAGATGCCAAATTATCTAACTTGTTTCTCCAGGCAAGCAGCCCAACAACAGGGACAGCT
CCCAGGAGCCAGTCAAGGTTGTCTGTCTGTCCATCCACTCAGGACATCTGCAGAATCTGTCACTGCGAA
GGGGATGAAGAGAGCCCCCTCATCACACCCTGTCGCTGCACTGGGACACTGCGCTTTGTCCACCAGTCC
TGCCTCCACCAGTGGATAAAGAGCTCAGATACACGCTGCTGTGAGCTCTGCAAGTATGACTTCATAATG
GAGACCAAGCTCAAACCCCTCCGGAAGTGGGAGAAACTACAGATGACCACAAGTGAAAGGAGGAAAATA
TTCTGCTCTGTCACATTCCACGTAATCGCGATCACCTGTGTGGTTTGGTCTTTGTATGTATTGATAGAC
CGGACAGCGGAGGAAATCAAGCAAGGCAATGACAATGGTGTCCTTGAATGGCCATTTTGGACAAAACTG
GTTGTGGTAGCCATTGGCTTCACAGGAGGTCTTGTCTTCATGTACGTACAGTGTAAAGTCTATGTTCAG
TTGTGGCGCAGGCTGAAGGCCTACAACCGTGTGATCTTTGTACAAAATTGCCCAGACACTGCCAAAAAA
CTGGAGAAGAACTTCTCATGTAATGTAAACACAGACATCAAAGATGCTGTGGTAGTGCCTGTACCACAA
ACAGGTGCAAATTCACTGCCATCTGCAGAGGGTGGCCCCCCTGAAGTTGTATCAGTCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_017923
Insert Size 819 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_017923.3
RefSeq Size 5389 bp
RefSeq ORF 819 bp
Locus ID 55016
UniProt ID Q8TCQ1
Domains RING
Protein Families Druggable Genome, Transmembrane
MW 30.9 kDa
Gene Summary MARCH1 is a member of the MARCH family of membrane-bound E3 ubiquitin ligases (EC 6.3.2.19). MARCH proteins add ubiquitin (see MIM 191339) to target lysines in substrate proteins, thereby signaling their vesicular transport between membrane compartments. MARCH1 downregulates the surface expression of major histocompatibility complex (MHC) class II molecules (see MIM 142880) and other glycoproteins by directing them to the late endosomal/lysosomal compartment (Bartee et al., 2004 [PubMed 14722266]; Thibodeau et al., 2008 [PubMed 18389477]; De Gassart et al., 2008 [PubMed 18305173]).[supplied by OMIM, Mar 2010]
Transcript Variant: This variant (2) lacks multiple exons at its 5' end and has a novel segment at its 5' end, compared to variant 1. These differences result in a protein (isoform 2) with a shorter and distinct N-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...