MXI1 (NM_005962) Human Untagged Clone

CAT#: SC312545

MXI1 (untagged)-Human MAX interactor 1 (MXI1), transcript variant 1



  "NM_005962" in other vectors (4)

CNY 2,400.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal anti-MXI1 antibody
    • 100 ul

CNY 5,250.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms bHLHc11; MAD2; MXD2; MXI
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_005962 edited
ATGGAGCGGGTGAAGATGATCAACGTGCAGCGTCTGCTGGAGGCTGCCGAGTTTTTGGAG
CGCCGGGAGCGAGAGTGTGAACATGGCTACGCCTCTTCATTCCCGTCCATGCCGAGCCCC
CGACTGCAGCATTCAAAGCCCCCACGGAGGTTGAGCCGGGCACAGAAACACAGCAGCGGG
AGCAGCAACACCAGCACTGCCAACAGATCTACACACAATGAGCTGGAAAAGAATCGACGA
GCTCATCTGCGCCTTTGTTTAGAACGCTTAAAAGTTCTGATTCCACTAGGACCAGACTGC
ACCCGGCACACAACACTTGGTTTGCTCAACAAAGCCAAAGCACACATCAAGAAACTTGAA
GAAGCTGAAAGAAAAAGCCAGCACCAGCTCGAGAATTTGGAACGAGAACAGAGATTTTTA
AAGTGGCGACTGGAACAGCTGCAGGGTCCTCAGGAGATGGAACGAATACGAATGGACAGC
ATTGGATCAACTATTTCTTCAGATCGTTCTGATTCAGAGCGAGAGGAGATTGAAGTGGAT
GTTGAAAGCACAGAGTTCTCCCATGGAGAAGTGGACAATATAAGTACCACCAGCATCAGT
GACATTGATGACCACAGCAGCCTGCCGAGTATTGGGAGTGACGAGGGTTACTCCAGTGCC
AGTGTCAAACTTTCATTCACTTCATAG
Restriction Sites Please inquire     
ACCN NM_005962
Insert Size 2400 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_005962.4.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_005962.4, NP_005953.4
RefSeq Size 3272 bp
RefSeq ORF 687 bp
Locus ID 4601
UniProt ID P50539
Domains HLH
Protein Families Druggable Genome, Transcription Factors
Gene Summary Expression of the c-myc gene, which produces an oncogenic transcription factor, is tightly regulated in normal cells but is frequently deregulated in human cancers. The protein encoded by this gene is a transcriptional repressor thought to negatively regulate MYC function, and is therefore a potential tumor suppressor. This protein inhibits the transcriptional activity of MYC by competing for MAX, another basic helix-loop-helix protein that binds to MYC and is required for its function. Defects in this gene are frequently found in patients with prostate tumors. Three alternatively spliced transcripts encoding different isoforms have been described. Additional alternatively spliced transcripts may exist but the products of these transcripts have not been verified experimentally. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (1), also referred to as SRbeta, encodes the predominant isoform (a). CCDS Note: The coding region has been updated to include an alternative exon that is more supported by the available transcript and protein data. The update completes the helix-loop-helix dimerization domain, which was previously truncated.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...