United States
Germany
Japan
United Kingdom
China
Myosin Phosphatase 2 (PPP1R12B) (NM_032103) Human Untagged Clone
CAT＃: SC312462
PPP1R12B (untagged)-Human protein phosphatase 1, regulatory (inhibitor) subunit 12B (PPP1R12B), transcript variant 3
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | MYPT2; PP1bp55 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_032103, the custom clone sequence may differ by one or more nucleotides
ATGGACAAAAATGAGAATGAAGAAGCAGATTTGGATGAGCAGTCCTCTAAGAGGCTGTCC ATCCGAGAGAGGAGGCGGCCCAAGGAACGACGAAGAGGCACAGGCATCAATTTCTGGACA AAGGATGAGGATGAAACTGATGGCTCTGAAGAGGTCAAAGAAACGTGGCATGAAAGACTT TCTAGGTTGGAATCGGGAGGTAGTAATCCTACAACCAGTGATTCTTACGGTGACCGGGCT TCAGCAAGAGCCCGTCGGGAGGCCCGGGAGGCCCGCCTAGCCACCCTGACCAGCCGTGTA GAAGAAGACAGCAACAGAGATTATAAAAAACTCTATGAGAGTGCTCTGACTGAAAACCAA AAACTGAAAACAAAACTTCAGGAAGCCCAGCTAGAGCTAGCAGATATAAAGTCCAAGCTT GAGAAGGTGGCCCAGCAGAAACAAGAAAAGACCTCTGACCGATCATCAGTGCTGGAGATG GAGAAACGGGAGAGGCGAGCCTTGGAGCGCAAAATGTCAGAAATGGAGGAAGAAATGAAG GTGTTAACAGAACTGAAATCCGACAACCAGAGGCTGAAAGATGAAAATGGTGCCCTCATC AGAGTCATCAGCAAACTGTCCAAG |
| Restriction Sites | Please inquire |
| ACCN | NM_032103 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_032103.1, NP_115286.1 |
| RefSeq Size | 2046 bp |
| RefSeq ORF | 627 bp |
| Locus ID | 4660 |
| UniProt ID | O60237 |
| Protein Families | Druggable Genome |
| Protein Pathways | Vascular smooth muscle contraction |
| Gene Summary | Myosin phosphatase is a protein complex comprised of three subunits: a catalytic subunit (PP1c-delta, protein phosphatase 1, catalytic subunit delta), a large regulatory subunit (MYPT, myosin phosphatase target) and small regulatory subunit (sm-M20). Two isoforms of MYPT have been isolated--MYPT1 and MYPT2, the first of which is widely expressed, and the second of which may be specific to heart, skeletal muscle, and brain. Each of the MYPT isoforms functions to bind PP1c-delta and increase phosphatase activity. This locus encodes both MYTP2 and M20. Alternatively spliced transcript variants encoding different isoforms have been identified. Related pseudogenes have been defined on the Y chromosome. [provided by RefSeq, Oct 2011] Transcript Variant: This variant (3) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation at a downstream start codon, compared to variant 8. The encoded isoform (c, also known as sm-M20 or hHS-M21 A) is shorter than isoform h. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC224579 | PPP1R12B (Myc-DDK-tagged)-Human protein phosphatase 1, regulatory (inhibitor) subunit 12B (PPP1R12B), transcript variant 3 |
CNY 3,990.00 |
|
| RC224579L3 | Lenti-ORF clone of PPP1R12B (Myc-DDK-tagged)-Human protein phosphatase 1, regulatory (inhibitor) subunit 12B (PPP1R12B), transcript variant 3 |
CNY 5,890.00 |
|
| RC224579L4 | Lenti-ORF clone of PPP1R12B (mGFP-tagged)-Human protein phosphatase 1, regulatory (inhibitor) subunit 12B (PPP1R12B), transcript variant 3 |
CNY 5,890.00 |
|
| RG224579 | PPP1R12B (tGFP-tagged) - Human protein phosphatase 1, regulatory (inhibitor) subunit 12B (PPP1R12B), transcript variant 3 |
CNY 4,370.00 |
其它Myosin Phosphatase 2产品
