Aprataxin (APTX) (NM_175071) Human Untagged Clone
CAT#: SC312289
APTX (untagged)-Human aprataxin (APTX), transcript variant 5
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AOA; AOA1; aprataxin; ataxia 1, early onset with hypoalbuminemia; AXA1; EAOH; EOAHA; FHA-HIT; FLJ20157; MGC1072; OTTHUMP00000021188 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC312289 representing NM_175071.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCAGGACCCCAAAATGCAGGTTTACAAAGATGAGCAGGTGGTGGTGATAAAGGATAAATACCCAAAG GCCCGTTACCATTGGCTGGTCTTACCGTGGACCTCCATTTCCAGTCTGAAGGCTGTGGCCAGGGAACAC CTTGAACTCCTTAAGCATATGCACACTGTGGGGGAAAAGGTGATTGTAGATTTTGCTGGGTCCAGCAAA CTCCGCTTCCGATTGGGCTACCACGCCATTCCGAGTATGAGCCATGTACATCTTCATGTGATCAGCCAG GATTTTGATTCTCCTTGCCTTAAAAACAAAAAACATTGGAATTCTTTCAATACAGAATACTTCCTAGAA TCACAAGCTGTGATCGAGATGGTACAAGAGGCTGGTAGAGTAACTGTCCGAGATGGGATGCCTGAGCTC TTGAAGCTGCCCCTTCGTTGTCATGAGTGCCAGCAGCTGCTGCCTTCCATTCCTCAGCTGAAAGAACAT CTCAGGAAGCACTGGACACAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_175071 |
Insert Size | 507 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_175071.1 |
RefSeq Size | 1836 bp |
RefSeq ORF | 507 bp |
Locus ID | 54840 |
Protein Families | Druggable Genome |
MW | 19.7 kDa |
Gene Summary | This gene encodes a member of the histidine triad (HIT) superfamily. The encoded protein may play a role in single-stranded DNA repair through its nucleotide-binding activity and its diadenosine polyphosphate hydrolase activity. Mutations in this gene have been associated with ataxia-ocular apraxia. Alternatively spliced transcript variants have been identified for this gene.[provided by RefSeq, Aug 2010] Transcript Variant: This variant (5) contains multiple differences in the 5' UTR and coding region compared to variant 1. These differences result in translation initiation at a downstream in-frame ATG and an isoform (d) with a shorter N-terminus compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC224363 | APTX (Myc-DDK-tagged)-Human aprataxin (APTX), transcript variant 5 |
CNY 2,400.00 |
|
RC224363L3 | Lenti ORF clone of Human aprataxin (APTX), transcript variant 5, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC224363L4 | Lenti ORF clone of Human aprataxin (APTX), transcript variant 5, mGFP tagged |
CNY 5,890.00 |
|
RG224363 | APTX (tGFP-tagged) - Human aprataxin (APTX), transcript variant 5 |
CNY 4,370.00 |
其它Aprataxin产品