PMS1 (BC008410) Human Untagged Clone

CAT#: SC312273

(untagged)-Human cDNA clone MGC:14544 IMAGE:4097623, complete cds



CNY 9,120.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
PMS1 mouse monoclonal antibody,clone OTI5E10
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HNPCC3; hPMS1; MLH2; PMSL1
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for BC008410, the custom clone sequence may differ by one or more nucleotides
ATGAAACAATTGCCTGCGGCAACAGTTCGACTCCTTTCAAGTTCTCAGATCATCACTTCG
GTGGTCAGTGTTGTAAAAGAGCTTATTGAAAACTCCTTGGATGCTGGTGCCACAAGCGTA
GATGTTAAACTGGAGAACTATGGATTTGATAAAATTGAGGTGCGAGATAACGGGGAGGGT
ATCAAGGCTGTTGATGCACCTGTAATGGCAATGAAGTACTACACCTCAAAAATAAATAGT
CATGAAGATCTTGAAAATTTGACAACTTACGGTTTTCGTGGAGAAGCCTTGGGGTCAATT
TGTTGTATAGCTGAGGTTTTAATTACAACAAGAACGGCTGCTGATAATTTTAGCACCCAG
TATGTTTTAGATGGCAGTGGCCACATACTTTCTCAGAAACCTTCACATCTTGGTCAAGGT
AAGAAAGTAGCTTTGTATACAAACATTCTTTACCTTTTCTGTCTTAATTGTTGGTTTAAA
AAAAAAAAAGTTACTCGG
Restriction Sites Please inquire     
ACCN BC008410
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC008410.1
RefSeq Size 1906 bp
RefSeq ORF 1906 bp
Locus ID 5378
Domains HATPase_c
Protein Families Druggable Genome, Transcription Factors
Gene Summary This gene encodes a protein belonging to the DNA mismatch repair mutL/hexB family. This protein is thought to be involved in the repair of DNA mismatches, and it can form heterodimers with MLH1, a known DNA mismatch repair protein. Mutations in this gene cause hereditary nonpolyposis colorectal cancer type 3 (HNPCC3) either alone or in combination with mutations in other genes involved in the HNPCC phenotype, which is also known as Lynch syndrome. [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Customer Reviews 
Loading...