XIAP (AK097085) Human Untagged Clone
CNY 9,120.00
货期*
4周
规格
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
经常一起买 (4)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for AK097085, the custom clone sequence may differ by one or more nucleotides
ATGGCTTTCTCTTTCTTCTTTCTTTCTTTTTTTTTTGAGACACAGTTTCGCTCTTGTTGC CCAGGCTGGAGTGCAATGGCACGATCACAACCTCCACCTCCTGGGTTCAAGCGATTCTCC TGCCTCAGTCTCCCGAGTAGCTGGGATTACAAGCATGTGTCACCACACCCAGCTAATTTT GTATTTTTAGTAGAGACGGGGTTTCTCCATGTTGGTCAGGCTGGTCTCGAACTCCCGACT TCAGGTGATCTGCCGGCCTCAGCCTCCCAAAGTGCTGGGATTACAGGCGGGAGCCACTTT GCCTGGCCTGGAATATGCCTTTTTCTATTGCTGTGCTTTATTCTGATTTTTGTTTTAGAA |
Restriction Sites | Please inquire |
ACCN | AK097085 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | AK097085.1 |
RefSeq Size | 2553 bp |
RefSeq ORF | 2553 bp |
Locus ID | 331 |
Protein Families | Druggable Genome |
Protein Pathways | Apoptosis, Focal adhesion, NOD-like receptor signaling pathway, Pathways in cancer, Small cell lung cancer, Ubiquitin mediated proteolysis |
Gene Summary | This gene encodes a protein that belongs to a family of apoptotic suppressor proteins. Members of this family share a conserved motif termed, baculovirus IAP repeat, which is necessary for their anti-apoptotic function. This protein functions through binding to tumor necrosis factor receptor-associated factors TRAF1 and TRAF2 and inhibits apoptosis induced by menadione, a potent inducer of free radicals, and interleukin 1-beta converting enzyme. This protein also inhibits at least two members of the caspase family of cell-death proteases, caspase-3 and caspase-7. Mutations in this gene are the cause of X-linked lymphoproliferative syndrome. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 2 and 11.[provided by RefSeq, Feb 2011] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Customer
Reviews
Loading...